>PTGES2|NM_025072|3'UTR
   1 ATGTCCCCGCGCAGAGCAGAGGGAAGGCAGCGGAAGACGCCAGCTGCCAGGGCCTGGGGCCACTGGGCCAGCGCCTGGCG
  81 ATACTGGTTGGGGGCAGGATCATTCTGCCCCTTGTCCACGCACCCCCACCAGCCCTCTCGCTTCTAACACAGGGCACCTG
 161 CTGGGGCTCAGGGATGTTAGGGACGAGTTCCAGCCCTGCCACTGCCCTGGGGCGACCCCTCCCTGTCCCTGCCTCCCTGC
 241 TCTGCCGCCCCTCTTCCTGGACCCTCAGTGGCTGTCCCATGGCTACATCCTGTGGGTGGGGGCCCTCGACAGGACAGCAG
 321 GACGGTTTGTTTTCAGTGGAATCCCATCCCTGGGTTCCCCTGGTTCCCACTCTTCCCAAGCCTCCCGGGACTGGGACATG
 401 TTTGCAATAAAGGAAAGGTTTGTGGCGCCTGTCATGGCAGGCATCTCATGGAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gcGGCCCGAGGGGCCCc 5' |:|||:||||| || Target 5' ccCTGGGTTCCCCTGGt 3'	348 - 364	135.00	-23.70
2	miRNA 3' gcGGCCCGAGGGGCCCc 5' || || :|||||| Target 5' tcCCAAGCCTCCCGGGa 3'	374 - 390	135.00	-18.70
3	miRNA 3' gcggcccGA-GGGGCCCc 5' || |||:||| Target 5' cctgccaCTGCCCTGGGg 3'	195 - 212	126.00	-22.20

Mutant ID	Mutant Position	Mutant Source
COSN31587838	89	COSMIC
COSN23017309	97	COSMIC
COSN30528813	140	COSMIC
COSN30143687	195	COSMIC
COSN28201542	278	COSMIC
COSN31778738	308	COSMIC
COSN7557208	311	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs980223008	2	dbSNP
rs1396872058	5	dbSNP
rs1300120186	7	dbSNP
rs201238358	8	dbSNP
rs746405466	9	dbSNP
rs1174396202	10	dbSNP
rs531086318	11	dbSNP
rs973864913	16	dbSNP
rs1198714481	21	dbSNP
rs1438763061	23	dbSNP
rs1277262734	28	dbSNP
rs201789766	31	dbSNP
rs751279204	32	dbSNP
rs1481901451	35	dbSNP
rs1335855120	36	dbSNP
rs574737432	38	dbSNP
rs554731903	39	dbSNP
rs1346448369	41	dbSNP
rs370822041	43	dbSNP
rs765127404	44	dbSNP
rs1232360272	47	dbSNP
rs759431217	48	dbSNP
rs776574800	49	dbSNP
rs891086522	53	dbSNP
rs1273663543	63	dbSNP
rs995607081	72	dbSNP
rs1028410476	73	dbSNP
rs1037109590	79	dbSNP
rs997315796	88	dbSNP
rs1196933403	91	dbSNP
rs907352998	92	dbSNP
rs904032645	96	dbSNP
rs1047453	105	dbSNP
rs1388737319	109	dbSNP
rs1046042805	117	dbSNP
rs1043943707	119	dbSNP
rs762416785	120	dbSNP
rs892760285	123	dbSNP
rs1056698249	124	dbSNP
rs541136618	125	dbSNP
rs1323376901	131	dbSNP
rs948957258	132	dbSNP
rs1441184478	135	dbSNP
rs572160832	139	dbSNP
rs558696738	142	dbSNP
rs1047460	144	dbSNP
rs539057146	147	dbSNP
rs1251668754	148	dbSNP
rs146605618	152	dbSNP
rs928268365	166	dbSNP
rs576337967	170	dbSNP
rs936443598	171	dbSNP
rs1468935097	178	dbSNP
rs979891580	184	dbSNP
rs948504297	185	dbSNP
rs866988519	191	dbSNP
rs925060235	192	dbSNP
rs752218070	193	dbSNP
rs961189115	195	dbSNP
rs557270480	205	dbSNP
rs1324878639	207	dbSNP
rs1438034723	213	dbSNP
rs1257948405	214	dbSNP
rs1461555014	217	dbSNP
rs879475611	218	dbSNP
rs1359515756	222	dbSNP
rs1168375880	230	dbSNP
rs1461447044	231	dbSNP
rs1296047438	237	dbSNP
rs1371060310	240	dbSNP
rs61092614	246	dbSNP
rs1294997162	247	dbSNP
rs954058337	252	dbSNP
rs766823486	253	dbSNP
rs1266306441	258	dbSNP
rs955419270	262	dbSNP
rs1487005309	263	dbSNP
rs1205881017	269	dbSNP
rs761211168	270	dbSNP
rs1255906942	277	dbSNP
rs1028332142	279	dbSNP
rs1190489749	286	dbSNP
rs1419261584	287	dbSNP
rs1028713425	296	dbSNP
rs898492552	301	dbSNP
rs996843307	302	dbSNP
rs542467758	307	dbSNP
rs568273734	308	dbSNP
rs1022384262	313	dbSNP
rs1015710832	315	dbSNP
rs35962613	315	dbSNP
rs1412752980	316	dbSNP
rs1314450238	320	dbSNP
rs772501862	321	dbSNP
rs1196821795	323	dbSNP
rs113129685	324	dbSNP
rs1304974400	328	dbSNP
rs892599769	335	dbSNP
rs1318739656	345	dbSNP
rs548360644	346	dbSNP
rs907384001	347	dbSNP
rs949003390	348	dbSNP
rs894686061	350	dbSNP
rs1054707770	351	dbSNP
rs1349094992	357	dbSNP
rs1004176528	360	dbSNP
rs1230636959	362	dbSNP
rs1159164190	363	dbSNP
rs936356023	367	dbSNP
rs371657859	368	dbSNP
rs186545126	369	dbSNP
rs1375773517	370	dbSNP
rs1409137417	374	dbSNP
rs1328950522	378	dbSNP
rs1390690167	379	dbSNP
rs905146157	382	dbSNP
rs551968693	386	dbSNP
rs1314703317	387	dbSNP
rs1435079949	392	dbSNP
rs1392078547	394	dbSNP
rs945102962	399	dbSNP
rs1346063214	415	dbSNP
rs948412301	417	dbSNP
rs986562302	419	dbSNP
rs1281505256	426	dbSNP
rs762267804	427	dbSNP
rs1028697310	431	dbSNP
rs973999522	435	dbSNP
rs1038049985	437	dbSNP
rs939858454	439	dbSNP
rs774775441	448	dbSNP
rs986748548	451	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.