>PRRC2A|NM_080686|3'UTR
   1 GGGAGTTCCTCTTGCCCCCTACCCCCGGGGCTTGTATATAGATTATAAATATATAAGGGGGAAAGGGGTGGGCGGGGAGG
  81 GGTTCTGGGGCTGGGGCCTCACTTCCCCTCCTCCCCCTTCCCCTGGTCCCCTGTCCCTGGGGCTGTTTGTTAAAAAAGAG
 161 TAATAAAAGGATTTAAAAAAAAAAACTTCTAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gauucugguucGGAGGAAGGGa 5' || ||||||| Target 5' cttcccctcctCCCCCTTCCCc 3'	102 - 123	147.00	-16.10
2	miRNA 3' gauucugguuCGGAGGAAGGGa 5' ||| ||| ||| Target 5' agttcctcttGCCCCCTACCCc 3'	4 - 25	120.00	-14.60
3	miRNA 3' gauucuGGUUCGGAGGA-AGGGA------- 5' || :|:| ||| ||||| Target 5' ccttccCCTGGTCCCCTGTCCCTGGGGCTG 3'	116 - 145	104.00	-16.50

Mutant ID	Mutant Position	Mutant Source
COSN30533788	4	COSMIC
COSN25751314	22	COSMIC
COSN31589982	50	COSMIC
COSN30536310	129	COSMIC
rs7889	86	GWAS

Mutant ID	Mutant Position	Mutant Source
rs778500678	1	dbSNP
rs563262842	5	dbSNP
rs1396957079	6	dbSNP
rs1487262199	6	dbSNP
rs749260409	7	dbSNP
rs372160042	10	dbSNP
rs1394014556	12	dbSNP
rs1393090196	16	dbSNP
rs777562558	17	dbSNP
rs1186922322	20	dbSNP
rs747676116	20	dbSNP
rs747038058	22	dbSNP
rs1230913364	23	dbSNP
rs569186695	26	dbSNP
rs776615138	27	dbSNP
rs530401550	28	dbSNP
rs1308165888	32	dbSNP
rs769528528	35	dbSNP
rs775208177	42	dbSNP
rs1213099733	45	dbSNP
rs1357572860	47	dbSNP
rs11538266	52	dbSNP
rs1294338326	53	dbSNP
rs1414572570	54	dbSNP
rs1353907090	57	dbSNP
rs1433354135	59	dbSNP
rs1300420626	65	dbSNP
rs28444972	65	dbSNP
rs1177798132	70	dbSNP
rs539595854	74	dbSNP
rs558006308	75	dbSNP
rs1159764337	79	dbSNP
rs1363053757	80	dbSNP
rs1398541525	83	dbSNP
rs7889	86	dbSNP
rs13195687	87	dbSNP
rs960246468	91	dbSNP
rs1346552526	101	dbSNP
rs1232413515	102	dbSNP
rs79774860	103	dbSNP
rs992959063	107	dbSNP
rs1388670351	113	dbSNP
rs984669527	114	dbSNP
rs907785628	117	dbSNP
rs1232828884	118	dbSNP
rs1311625948	131	dbSNP
rs1309593200	133	dbSNP
rs1392553142	138	dbSNP
rs1373211912	139	dbSNP
rs966499341	144	dbSNP
rs868675306	146	dbSNP
rs1355848892	152	dbSNP
rs1045987668	158	dbSNP
rs1459535113	161	dbSNP
rs978270185	161	dbSNP
rs1262121943	165	dbSNP
rs1365388236	173	dbSNP
rs1469879860	175	dbSNP
rs538804134	175	dbSNP
rs928511537	175	dbSNP
rs936356627	175	dbSNP
rs974373684	175	dbSNP
rs939403672	176	dbSNP
rs1192521458	180	dbSNP
rs933202007	184	dbSNP
rs749577868	186	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.