>POTEG|NM_001005356|3'UTR
   1 GCTTTCTCTTAGTTATAAGAAAGAAAAAGACCTCTTGCATGAAAATAGTACGTTGCAGGAAGAAATTGTCATGCTAAGAC
  81 TGGAACTAGACGTAATGAAACATCAGAGCCAGCTAAGAGAAAAGAAATATTTGGAGGAAATTGAAAGTGTGGAAAAAAAG
 161 AATGATAATCTTTTAAAGGGTCTACAACTGAATGAGCTCACCATGGATGATGATACTGCCGTGCTCGTCATTGACAACGG
 241 CTCTGGCATGTGCAAGGCCGGCTTTGCAGGTGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGTGCCCCAGGC
 321 ACCAGAACATGATGGGGGGCATGCGTC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugaAAGGGAAGU--CU-----CG-GACCGa 5' | |:| ||| || || ||||| Target 5' ccgTGCTCGTCATTGACAACGGCTCTGGCa 3'	219 - 248	117.00	-14.60
2	miRNA 3' ugAAAGGGAAGUCUCGGACCga 5' || :| | | || |||| Target 5' aaTTGTCATGCTAAGACTGGaa 3'	64 - 85	104.00	-7.30
3	miRNA 3' ugaaaggGAAGUCUCGGACcga 5' | |||||||| | Target 5' aatgaaaCATCAGAGCCAGcta 3'	94 - 115	95.00	-15.60

Mutant ID	Mutant Position	Mutant Source
COSN23974885	22	COSMIC
COSN16302451	1364	COSMIC
COSN19614636	1674	COSMIC
COSN19614635	1756	COSMIC
COSN19614634	1834	COSMIC
COSN30163890	2012	COSMIC
COSN5265959	2041	COSMIC
COSN5265958	2043	COSMIC
COSN5265957	2053	COSMIC
COSN28537963	2056	COSMIC
COSN5265956	2065	COSMIC
COSN5265955	2067	COSMIC
COSN30468560	2070	COSMIC
COSN5265954	2076	COSMIC
COSN5265953	2078	COSMIC
COSN5265952	2081	COSMIC
COSN5265950	2092	COSMIC
COSN5265949	2107	COSMIC
COSN5265948	2108	COSMIC
COSN5265947	2110	COSMIC
COSN5265946	2112	COSMIC
COSN5265945	2116	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1367048309	9	dbSNP
rs1469293350	22	dbSNP
rs1298778425	92	dbSNP
rs1339930278	138	dbSNP
rs1398292773	147	dbSNP
rs1295293082	150	dbSNP
rs1322563043	193	dbSNP
rs1244470913	213	dbSNP
rs1264078227	278	dbSNP
rs1419913231	337	dbSNP
rs879969444	638	dbSNP
rs879256404	686	dbSNP
rs1963213	868	dbSNP
rs560809316	879	dbSNP
rs1375992389	938	dbSNP
rs1353333967	992	dbSNP
rs1217983334	1012	dbSNP
rs1263168165	1013	dbSNP
rs1487640417	1044	dbSNP
rs1174157901	1048	dbSNP
rs2818539	1103	dbSNP
rs1974389	1114	dbSNP
rs2818538	1161	dbSNP
rs1309645580	1186	dbSNP
rs1373534450	1216	dbSNP
rs1424051565	1225	dbSNP
rs1163694502	1226	dbSNP
rs1366469540	1231	dbSNP
rs1281620208	1236	dbSNP
rs1421361803	1249	dbSNP
rs1203388806	1252	dbSNP
rs1159167891	1255	dbSNP
rs1481203991	1258	dbSNP
rs1209449447	1281	dbSNP
rs1265592193	1293	dbSNP
rs1455617274	1299	dbSNP
rs1194369866	1305	dbSNP
rs1389426169	1326	dbSNP
rs1359841218	1327	dbSNP
rs1398159208	1335	dbSNP
rs1304696284	1352	dbSNP
rs1380103326	1353	dbSNP
rs1457262478	1358	dbSNP
rs1395634726	1364	dbSNP
rs1392471026	1373	dbSNP
rs1310930344	1376	dbSNP
rs1440941580	1394	dbSNP
rs1379553525	1397	dbSNP
rs1365023794	1404	dbSNP
rs1241339503	1411	dbSNP
rs1298448057	1413	dbSNP
rs1285850498	1420	dbSNP
rs1032910346	1425	dbSNP
rs1352190192	1426	dbSNP
rs958307375	1427	dbSNP
rs1257220377	1428	dbSNP
rs1470010283	1437	dbSNP
rs1214336280	1441	dbSNP
rs1483314987	1442	dbSNP
rs1463650017	1448	dbSNP
rs1180921831	1450	dbSNP
rs1420189130	1454	dbSNP
rs1422987215	1455	dbSNP
rs1379408517	1456	dbSNP
rs1253714232	1459	dbSNP
rs1461647340	1460	dbSNP
rs1319558535	1468	dbSNP
rs1385793397	1469	dbSNP
rs1436705469	1472	dbSNP
rs1291109834	1479	dbSNP
rs974706714	1489	dbSNP
rs1441255546	1523	dbSNP
rs1179032314	1527	dbSNP
rs1337139718	1546	dbSNP
rs1312137183	1558	dbSNP
rs1379575039	1559	dbSNP
rs1417814346	1562	dbSNP
rs1218079701	1570	dbSNP
rs1242582801	1592	dbSNP
rs1178208940	1598	dbSNP
rs2818537	1599	dbSNP
rs1475447300	1607	dbSNP
rs1409357196	1608	dbSNP
rs1465656816	1609	dbSNP
rs1301253420	1614	dbSNP
rs1301673395	1619	dbSNP
rs1357742611	1631	dbSNP
rs1415827184	1636	dbSNP
rs775105249	1637	dbSNP
rs1327370803	1656	dbSNP
rs1447929082	1662	dbSNP
rs1285054184	1665	dbSNP
rs1311751951	1667	dbSNP
rs1402731668	1667	dbSNP
rs1207921620	1670	dbSNP
rs879133646	1674	dbSNP
rs1485856634	1676	dbSNP
rs1181223622	1677	dbSNP
rs1375207420	1691	dbSNP
rs1221404792	1702	dbSNP
rs1302669462	1706	dbSNP
rs1423850218	1714	dbSNP
rs1412315413	1718	dbSNP
rs1172288916	1726	dbSNP
rs1312252870	1727	dbSNP
rs1208835243	1728	dbSNP
rs1348788005	1734	dbSNP
rs1253816544	1745	dbSNP
rs1458840705	1746	dbSNP
rs1198990963	1753	dbSNP
rs1967468	1756	dbSNP
rs61968818	1759	dbSNP
rs1192832949	1766	dbSNP
rs1425797227	1767	dbSNP
rs1432592932	1781	dbSNP
rs1204758526	1783	dbSNP
rs1245818336	1785	dbSNP
rs1476733810	1791	dbSNP
rs1174082928	1792	dbSNP
rs1397366683	1804	dbSNP
rs1455089814	1807	dbSNP
rs1402665745	1816	dbSNP
rs1168592085	1817	dbSNP
rs1029036834	1819	dbSNP
rs1412047926	1824	dbSNP
rs1466316266	1824	dbSNP
rs1330978184	1829	dbSNP
rs1398554404	1830	dbSNP
rs879028021	1834	dbSNP
rs1305730588	1850	dbSNP
rs1294572821	1851	dbSNP
rs1295389611	1852	dbSNP
rs1341180815	1856	dbSNP
rs1214983248	1857	dbSNP
rs1288644194	1864	dbSNP
rs1449532970	1876	dbSNP
rs1367523077	1882	dbSNP
rs1218092966	1885	dbSNP
rs1280841127	1891	dbSNP
rs1319448586	1928	dbSNP
rs1371893755	1929	dbSNP
rs1218832338	1932	dbSNP
rs1257093361	1943	dbSNP
rs1413265174	1946	dbSNP
rs1435801607	1949	dbSNP
rs1223498673	1950	dbSNP
rs1247169420	1954	dbSNP
rs1488128944	1958	dbSNP
rs1316095124	1963	dbSNP
rs1189450746	1965	dbSNP
rs1431124183	1970	dbSNP
rs1425830376	1975	dbSNP
rs1478227180	1977	dbSNP
rs1170222993	1982	dbSNP
rs1234737789	1986	dbSNP
rs1327835757	1992	dbSNP
rs1421776037	1993	dbSNP
rs1260193027	1995	dbSNP
rs1407369246	1999	dbSNP
rs1165968396	2003	dbSNP
rs1349763748	2004	dbSNP
rs1237256999	2007	dbSNP
rs1167343998	2012	dbSNP
rs1418898841	2014	dbSNP
rs1456737205	2015	dbSNP
rs1386968989	2024	dbSNP
rs1382707059	2026	dbSNP
rs1333495061	2027	dbSNP
rs1434922361	2029	dbSNP
rs1353311140	2030	dbSNP
rs528375444	2032	dbSNP
rs1293489638	2033	dbSNP
rs1349522768	2034	dbSNP
rs1300634643	2035	dbSNP
rs1261972561	2036	dbSNP
rs539814982	2038	dbSNP
rs1341817367	2039	dbSNP
rs752253694	2043	dbSNP
rs1278598485	2046	dbSNP
rs954760515	2051	dbSNP
rs564553175	2055	dbSNP
rs1337072431	2056	dbSNP
rs1454420300	2066	dbSNP
rs1171899753	2068	dbSNP
rs1229768899	2070	dbSNP
rs2716255	2071	dbSNP
rs1389315115	2072	dbSNP
rs1320935309	2074	dbSNP
rs1335809662	2080	dbSNP
rs940852358	2084	dbSNP
rs1220152628	2087	dbSNP
rs1303262130	2089	dbSNP
rs1346368322	2092	dbSNP
rs1213384614	2093	dbSNP
rs532010974	2095	dbSNP
rs550625631	2097	dbSNP
rs974095192	2104	dbSNP
rs756178869	2108	dbSNP
rs1488625506	2109	dbSNP
rs568906412	2117	dbSNP
rs113164661	2119	dbSNP
rs1261255505	2123	dbSNP
rs1473912249	2124	dbSNP
rs1393135257	2126	dbSNP
rs1182714227	2129	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.