pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-548t |
Genomic Coordinates | chr4: 173268160 - 173268233 |
Description | Homo sapiens miR-548t stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-548t-3p | |||||||||||||||||||||||||||||||||||
Sequence | 46| AAAAACCACAAUUACUUUUGCACCA |70 | |||||||||||||||||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||||||||||||||||
Experiments | ||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | POLR2D | ||||||||||||||||||||
Synonyms | HSRBP4, HSRPB4, RBP4, RPB16 | ||||||||||||||||||||
Description | RNA polymerase II subunit D | ||||||||||||||||||||
Transcript | NM_004805 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on POLR2D | |||||||||||||||||||||
3'UTR of POLR2D (miRNA target sites are highlighted) |
>POLR2D|NM_004805|3'UTR 1 TCTCCAAACATCACTGCTGCTCGGAGAAACCACATCCCCAGGCATAACACCACCTTCCCACTGTCTGGGGCTGACTTGCA 81 CAGAAATTCTGTTGAAGACAGTTGAGAATTCCTTTGGAGAAAACAGCCCAGCTTGGCGTGGGGTTAGGTTGCTGTTTCAA 161 ATAACTCACAGGCCCAGGTGACATGGAATCTTGGAGCAGCCTTGTGCAGTGGCAGCCAGTGGCTTCCTGAACGTGCCTCT 241 GCGAAGTGTGAGATGAGGGGTCACATAACCACACTGTTGACTACCTCATTCCTGGTTTTTGGCCTCCACATCATCTTTTT 321 TCTTAATATTTCATGTTTTAATTTCAGGGTGTTTATACTTTTTGAAACTAGACCAGAAGATAGTAGACTTTATAGAGAAA 401 GACCAGTTTTACCTAGATACTAAAGGAAGAATTAAACCGCTGTTAGTTTGAAATGCTTTTTTTTTTTTTTTTTAAATGGA 481 GATAGGGTCTTAACTCTTGTCCAGGCTGGAGGAGTGCAGTCGTACAGTCATGGCTCACTGAAGTCTTGACCCCGCTGCCT 561 CAGCCTCCCAAATAACTGGGGCCACAGGTGTGCACCACAACTCTCAGCTAATTTTTAAAATTTTTTATAGAGGTGGGGTT 641 TTACTATGCTGTCCAGACTGGTCTTAAACTCCTGGGCTCAAGTGATCCCCCTGCCTTGGCCTCCCAAACTGGTGAGATTA 721 CAGGCATGAGCCACCACAACTGGCCTGAAATTCTTAAAGGATGGGAGTGTCGATGACAGCACCTTGGCATCGTTGTGCCT 801 AACCTGGGAGACGGAAGAAGCACGCCATGGGAAGTGTTTACACTTGGGGACAAGTGCTAAGTATTGTGGAGCCCATAGCC 881 CCTTGAGATAGATGGCTACTTTGCCTTTCTTCTTGAACTGTCTTGCAGAATGTGGATTTGGGGTAAGTGGTCTTGAAGGA 961 TTCATTTAGTCACCCTCAAATTAAGATTTTTACTTCATCTTTCTTGGGCCTGCACCTCCAAGATAACAAAGAAGAAGCAA 1041 TGGTCGTGCCAAAGAGGTCCACAACCAGGTGTGCACTGTTCACTGCAGCCCATTTGCTGTATGAACTGTGGTTGTTGTGT 1121 GCCCAATGACAAGGCTACTAAGAAATTCATCATTTGAAACGTAGAGGCCGCAGCAGTCAGCGATGTTTCTGAAATGAGCA 1201 TCCTTGACGCCTGTGTACTTCCCAGGCTGGATGTGAAGCTACATTACCATGTGAGTTGTGCCATTCACAGCACAGTGGTG 1281 AGGAATTGAGCTCATGAAGCAGGCAAGGACCGAACACCTCCACCCCAACGTAGACCTGCAGGTGCTGCCCCATGACCTCC 1361 ACCAAAGCCCATATAAGGAGCGGAGTTGTTAAGGACTGAAGAAAAACTTCTCTGGAGAAAAATAAAATTGCAATTCTACT 1441 TAAAAAAATTTTTTTTTTTTTTTACTTCATAGGCCAGGCTTGAAGTTCTGAACACTTTGAAGTCTCCAATTATGAGAGAT 1521 CCAGTCTAAGCCTCTGGCCTGCTAATTAGCAATAAGTGCTTTATTTGGAAGGAGGGAGTCATCCACTCTTGAGCCACTGC 1601 AGTGAAGTCACTTGATCTCAGTCTGGGGGAAAACACTTCAATAGCTAAACATTCTAGCTTTGATTTTTCTGAAGGGAATA 1681 CACTTGTTTTCAATTTTGGGGTTTTTCTTTGGGGCACTTGCTTGACTCTGTATGAACTTGTGATCCAAGGAAAAAGGAGA 1761 AAGAACAGTGTTGGCTTTTAAAATCAGGATGGTTTTATGTTTGCTACGAAATAAGGCAAGAATAAAAAATTCTTATTTTT 1841 AAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 5433.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10
PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000272645.4 | 3UTR | UCACAUAACCACACUGUUGACUACCUCAUUCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000272645.4 | 3UTR | UCACAUAACCACACUGUUGACUACCUCAUUCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
168 hsa-miR-548t-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059365 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT072839 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076945 | PCGF2 | polycomb group ring finger 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT083941 | TFAP2C | transcription factor AP-2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT085401 | ETS2 | ETS proto-oncogene 2, transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT109790 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT114046 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
![]() |
2 | 10 | ||||||
MIRT130165 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT150013 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT181258 | ASH1L | ASH1 like histone lysine methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT205594 | NCL | nucleolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT222253 | ACTB | actin beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT245653 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT250947 | CDK5R1 | cyclin dependent kinase 5 regulatory subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT252497 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT271990 | ARF1 | ADP ribosylation factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT280804 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT293803 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT318231 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT341455 | ATP6V0B | ATPase H+ transporting V0 subunit b | ![]() |
![]() |
2 | 2 | ||||||
MIRT347413 | CEBPG | CCAAT/enhancer binding protein gamma | ![]() |
![]() |
2 | 4 | ||||||
MIRT351860 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT357983 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT377094 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT407303 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441564 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442364 | ZC3H12C | zinc finger CCCH-type containing 12C | ![]() |
![]() |
2 | 2 | ||||||
MIRT443228 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT443404 | HMX3 | H6 family homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446055 | NR5A2 | nuclear receptor subfamily 5 group A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448277 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450822 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453016 | CCDC115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 17 | ||||||
MIRT454463 | PPP2R2B | protein phosphatase 2 regulatory subunit Bbeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT456360 | CITED2 | Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460007 | DNALI1 | dynein axonemal light intermediate chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463154 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 6 | ||||||
MIRT463766 | YPEL2 | yippee like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468310 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470668 | POLR2D | RNA polymerase II subunit D | ![]() |
![]() |
2 | 4 | ||||||
MIRT478517 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT480507 | C11orf57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484718 | INHBA | inhibin beta A subunit | ![]() |
![]() |
2 | 12 | ||||||
MIRT485494 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487302 | SLC38A9 | solute carrier family 38 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487771 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | ![]() |
![]() |
2 | 16 | ||||||
MIRT491876 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT494304 | CEP120 | centrosomal protein 120 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495396 | TRIM24 | tripartite motif containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495646 | CDK1 | cyclin dependent kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496665 | TMEM237 | transmembrane protein 237 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496837 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498638 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 10 | ||||||
MIRT503928 | FBXL13 | F-box and leucine rich repeat protein 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506063 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT506582 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506606 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT506844 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508536 | RPP14 | ribonuclease P/MRP subunit p14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT509669 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 10 | ||||||
MIRT511170 | MBNL3 | muscleblind like splicing regulator 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512147 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512831 | ID4 | inhibitor of DNA binding 4, HLH protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT514558 | XRCC3 | X-ray repair cross complementing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515856 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521848 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT525364 | SYNM | synemin | ![]() |
![]() |
2 | 2 | ||||||
MIRT527120 | ARHGAP15 | Rho GTPase activating protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527271 | FBLN2 | fibulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527439 | COL4A3 | collagen type IV alpha 3 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT527658 | CD300E | CD300e molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT528334 | TBC1D22B | TBC1 domain family member 22B | ![]() |
![]() |
2 | 2 | ||||||
MIRT529033 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529321 | PDE5A | phosphodiesterase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT529677 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529846 | SMTN | smoothelin | ![]() |
![]() |
2 | 2 | ||||||
MIRT530385 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530913 | GPR85 | G protein-coupled receptor 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531794 | KDR | kinase insert domain receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT532246 | KLF2 | Kruppel like factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532658 | CBX7 | chromobox 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533630 | TMX3 | thioredoxin related transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534811 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT534975 | PSD3 | pleckstrin and Sec7 domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536588 | ITPKB | inositol-trisphosphate 3-kinase B | ![]() |
![]() |
2 | 2 | ||||||
MIRT536779 | HNRNPD | heterogeneous nuclear ribonucleoprotein D | ![]() |
![]() |
2 | 2 | ||||||
MIRT538764 | CABLES1 | Cdk5 and Abl enzyme substrate 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539294 | ANGEL2 | angel homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539621 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539651 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540347 | OPHN1 | oligophrenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540413 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541396 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542916 | HSBP1 | heat shock factor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544710 | EIF5A | eukaryotic translation initiation factor 5A | ![]() |
![]() |
2 | 4 | ||||||
MIRT544998 | MFF | mitochondrial fission factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT553289 | TSPAN3 | tetraspanin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553455 | TNRC6C | trinucleotide repeat containing 6C | ![]() |
![]() |
2 | 2 | ||||||
MIRT553782 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554656 | ROBO1 | roundabout guidance receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555104 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT557235 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560861 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561545 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT561554 | SLMO2 | PRELI domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT563764 | ZNF678 | zinc finger protein 678 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565653 | SIX4 | SIX homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568080 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568759 | MYBL1 | MYB proto-oncogene like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569078 | CADM2 | cell adhesion molecule 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569509 | THYN1 | thymocyte nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571268 | CDKN2AIP | CDKN2A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT571809 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572554 | DKK3 | dickkopf WNT signaling pathway inhibitor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573782 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT576441 | Ccdc115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 10 | ||||||
MIRT576712 | Slc30a3 | solute carrier family 30 (zinc transporter), member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT608377 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608484 | NKTR | natural killer cell triggering receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT610186 | FAM49A | family with sequence similarity 49 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT611631 | EDIL3 | EGF like repeats and discoidin domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613534 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT616221 | PTPN11 | protein tyrosine phosphatase, non-receptor type 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622370 | SALL1 | spalt like transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624371 | CDK12 | cyclin dependent kinase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624995 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626875 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT627737 | RAP2B | RAP2B, member of RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT628490 | ADAT2 | adenosine deaminase, tRNA specific 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633647 | PLEKHG7 | pleckstrin homology and RhoGEF domain containing G7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT634028 | SLC30A3 | solute carrier family 30 member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT635923 | GLTSCR2 | NOP53 ribosome biogenesis factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT638287 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641959 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643573 | CTNNA3 | catenin alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645180 | NOL9 | nucleolar protein 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT647497 | ZNF639 | zinc finger protein 639 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647682 | PCK1 | phosphoenolpyruvate carboxykinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648422 | MYOZ3 | myozenin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650113 | ZCCHC9 | zinc finger CCHC-type containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651076 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT651415 | ZADH2 | zinc binding alcohol dehydrogenase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651456 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653619 | SLC30A4 | solute carrier family 30 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653637 | SLC30A1 | solute carrier family 30 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654896 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656483 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658016 | GABRA4 | gamma-aminobutyric acid type A receptor alpha4 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT658041 | FZD10 | frizzled class receptor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660093 | BTBD3 | BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663923 | MAGEF1 | MAGE family member F1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665882 | TGIF2 | TGFB induced factor homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669051 | CEP128 | centrosomal protein 128 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669711 | AAGAB | alpha and gamma adaptin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT686812 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT689883 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693274 | GLRX2 | glutaredoxin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT697056 | BCAR1 | BCAR1, Cas family scaffolding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT703297 | GID4 | GID complex subunit 4 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT704087 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707719 | CDC6 | cell division cycle 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708136 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT709212 | KLHL30 | kelch like family member 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710062 | RWDD2A | RWD domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712770 | POU6F2 | POU class 6 homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715073 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715387 | TADA3 | transcriptional adaptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717712 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|