pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-605 |
Genomic Coordinates | chr10: 51299573 - 51299655 |
Synonyms | MIRN605, hsa-mir-605, MIR605 |
Description | Homo sapiens miR-605 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-605-3p | ||||||||||||||||||||||||||||
Sequence | 51| AGAAGGCACUAUGAGAUUUAGA |72 | ||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PMP22 | ||||||||||||||||||||
Synonyms | CIDP, CMT1A, CMT1E, DSS, GAS-3, GAS3, HMSNIA, HNPP, Sp110 | ||||||||||||||||||||
Description | peripheral myelin protein 22 | ||||||||||||||||||||
Transcript | NM_000304 | ||||||||||||||||||||
Other Transcripts | NM_153321 , NM_153322 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PMP22 | |||||||||||||||||||||
3'UTR of PMP22 (miRNA target sites are highlighted) |
>PMP22|NM_000304|3'UTR 1 GGCGCCCAGACGGTCTGTCTGAGGCTCTGAGCGTACATAGGGAAGGGAGGAAGGGAAAACAGAAAGCAGACAAAGAAAAA 81 AGAGCTAGCCCAAAATCCCAAACTCAAACCAAACCAAACAGAAAGCAGTGGAGGTGGGGGTTGCTGTTGATTGAAGATGT 161 ATATAATATCTCCGGTTTATAAAACCTATTTATAACACTTTTTACATATATGTACATAGTATTGTTTGCTTTTTATGTTG 241 ACCATCAGCCTCGTGTTGAGCCTTAAAGAAGTAGCTAAGGAACTTTACATCCTAACAGTATAATCCAGCTCAGTATTTTT 321 GTTTTGTTTTTTGTTTGTTTGTTTTGTTTTACCCAGAAATAAGATAACTCCATCTCGCCCCTTCCCTTTCATCTGAAAGA 401 AGATACCTCCCTCCCAGTCCACCTCATTTAGAAAACCAAAGTGTGGGTAGAAACCCCAAATGTCCAAAAGCCCTTTTCTG 481 GTGGGTGACCCAGTGCATCCAACAGAAACAGCCGCTGCCCGAACCTCTGTGTGAAGCTTTACGCGCACACGGACAAAATG 561 CCCAAACTGGAGCCCTTGCAAAAACACGGCTTGTGGCATTGGCATACTTGCCCTTACAGGTGGAGTATCTTCGTCACACA 641 TCTAAATGAGAAATCAGTGACAACAAGTCTTTGAAATGGTGCTATGGATTTACCATTCCTTATTATCACTAATCATCTAA 721 ACAACTCACTGGAAATCCAATTAACAATTTTACAACATAAGATAGAATGGAGACCTGAATAATTCTGTGTAATATAAATG 801 GTTTATAACTGCTTTTGTACCTAGCTAGGCTGCTATTATTACTATAATGAGTAAATCATAAAGCCTTCATCACTCCCACA 881 TTTTTCTTACGGTCGGAGCATCAGAACAAGCGTCTAGACTCCTTGGGACCGTGAGTTCCTAGAGCTTGGCTGGGTCTAGG 961 CTGTTCTGTGCCTCCAAGGACTGTCTGGCAATGACTTGTATTGGCCACCAACTGTAGATGTATATATGGTGCCCTTCTGA 1041 TGCTAAGACTCCAGACCTTTTGTTTTTGCTTTGCATTTTCTGATTTTATACCAACTGTGTGGACTAAGATGCATTAAAAT 1121 AAACATCAGAGTAACTCACT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000395938.2 | 3UTR | CCUUCAUCACUCCCACAUUUUUCUUACGGUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
100 hsa-miR-605-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT061339 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT061584 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076140 | WDR81 | WD repeat domain 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT079361 | CCDC137 | coiled-coil domain containing 137 | ![]() |
![]() |
2 | 2 | ||||||
MIRT079547 | VAMP3 | vesicle associated membrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT096242 | CANX | calnexin | ![]() |
![]() |
2 | 2 | ||||||
MIRT243877 | G3BP1 | G3BP stress granule assembly factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT249186 | AKIRIN1 | akirin 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT273604 | SP1 | Sp1 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT316766 | FOXC1 | forkhead box C1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT322410 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT370117 | TRIB3 | tribbles pseudokinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT392725 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT406910 | PTBP1 | polypyrimidine tract binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT407440 | CTDSP1 | CTD small phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441887 | RD3 | retinal degeneration 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT444979 | C15orf52 | chromosome 15 open reading frame 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445241 | FOXD4 | forkhead box D4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445500 | FOXD4L5 | forkhead box D4 like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445503 | FOXD4L4 | forkhead box D4 like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447025 | FOXD4L1 | forkhead box D4 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447743 | TMCC3 | transmembrane and coiled-coil domain family 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448761 | HDX | highly divergent homeobox | ![]() |
![]() |
2 | 2 | ||||||
MIRT450003 | HAX1 | HCLS1 associated protein X-1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452830 | FAM131B | family with sequence similarity 131 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452872 | LAX1 | lymphocyte transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453506 | ARRB1 | arrestin beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454169 | HIST1H2BK | histone cluster 1 H2B family member k | ![]() |
![]() |
2 | 2 | ||||||
MIRT458742 | CES2 | carboxylesterase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459166 | HSPA6 | heat shock protein family A (Hsp70) member 6 | ![]() |
![]() |
2 | 21 | ||||||
MIRT460246 | IL17RB | interleukin 17 receptor B | ![]() |
![]() |
2 | 4 | ||||||
MIRT460514 | SDE2 | SDE2 telomere maintenance homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT460698 | RNF157 | ring finger protein 157 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461481 | METTL1 | methyltransferase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462617 | C20orf27 | chromosome 20 open reading frame 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT463233 | ZNF131 | zinc finger protein 131 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465699 | TNPO2 | transportin 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT466304 | TIMM22 | translocase of inner mitochondrial membrane 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468957 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 6 | ||||||
MIRT469571 | RARA | retinoic acid receptor alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT469685 | RAB5B | RAB5B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT470800 | PMP22 | peripheral myelin protein 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471649 | PANK2 | pantothenate kinase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT471722 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472281 | NFIB | nuclear factor I B | ![]() |
![]() |
2 | 4 | ||||||
MIRT473680 | MAPKBP1 | mitogen-activated protein kinase binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475859 | H6PD | hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT477326 | EPHA2 | EPH receptor A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477831 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478572 | CTNND1 | catenin delta 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479634 | CD81 | CD81 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT481950 | ANKRD11 | ankyrin repeat domain 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483696 | ZNF74 | zinc finger protein 74 | ![]() |
![]() |
2 | 6 | ||||||
MIRT488798 | MALT1 | MALT1 paracaspase | ![]() |
![]() |
2 | 2 | ||||||
MIRT489066 | STARD3 | StAR related lipid transfer domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492533 | PSMD11 | proteasome 26S subunit, non-ATPase 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492857 | NRARP | NOTCH regulated ankyrin repeat protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT496793 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT500122 | ZNF106 | zinc finger protein 106 | ![]() |
![]() |
2 | 4 | ||||||
MIRT505359 | TMEM167A | transmembrane protein 167A | ![]() |
![]() |
2 | 2 | ||||||
MIRT506786 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510692 | SRM | spermidine synthase | ![]() |
![]() |
2 | 6 | ||||||
MIRT515841 | CEP104 | centrosomal protein 104 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516448 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT528855 | PKP1 | plakophilin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533848 | TET3 | tet methylcytosine dioxygenase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539025 | ATXN7L1 | ataxin 7 like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542872 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546543 | SATB2 | SATB homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554114 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560569 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560796 | EPM2AIP1 | EPM2A interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562836 | GCFC2 | GC-rich sequence DNA-binding factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563109 | IFRD2 | interferon related developmental regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564177 | MRPL49 | mitochondrial ribosomal protein L49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564283 | ASB1 | ankyrin repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564350 | USP22 | ubiquitin specific peptidase 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565279 | TNFRSF21 | TNF receptor superfamily member 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565338 | TMEM104 | transmembrane protein 104 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565905 | SCAMP2 | secretory carrier membrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567108 | ITGB1 | integrin subunit beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567601 | FANCF | Fanconi anemia complementation group F | ![]() |
![]() |
2 | 2 | ||||||
MIRT567779 | DGAT2 | diacylglycerol O-acyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568075 | CENPQ | centromere protein Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT624304 | COL12A1 | collagen type XII alpha 1 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT644395 | CDKL1 | cyclin dependent kinase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661547 | ZNF674 | zinc finger protein 674 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670949 | IRAK3 | interleukin 1 receptor associated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672951 | AKAP5 | A-kinase anchoring protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697426 | ZFP36 | ZFP36 ring finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT700793 | PIAS2 | protein inhibitor of activated STAT 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702657 | ITGA3 | integrin subunit alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708945 | FZR1 | fizzy and cell division cycle 20 related 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713657 | PLCE1 | phospholipase C epsilon 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719239 | CYSLTR2 | cysteinyl leukotriene receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719951 | BLOC1S6 | biogenesis of lysosomal organelles complex 1 subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722048 | HLA-E | major histocompatibility complex, class I, E | ![]() |
![]() |
2 | 2 | ||||||
MIRT722201 | URM1 | ubiquitin related modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724790 | C1D | C1D nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT734347 | CYP2B6 | cytochrome P450 family 2 subfamily B member 6 | ![]() |
![]() |
![]() |
3 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|