| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-921 |
| Genomic Coordinates | chr1: 166154743 - 166154798 |
| Synonyms | MIRN921, hsa-mir-921, MIR921 |
| Description | Homo sapiens miR-921 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-921 | ||||||||||||
| Sequence | 2| CUAGUGAGGGACAGAACCAGGAUUC |26 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Cloned | DRVs in miRNA |
|
||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | PAQR5 | ||||||||||||||||||||
| Synonyms | MPRG | ||||||||||||||||||||
| Description | progestin and adipoQ receptor family member 5 | ||||||||||||||||||||
| Transcript | NM_001104554 | ||||||||||||||||||||
| Other Transcripts | NM_017705 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on PAQR5 | |||||||||||||||||||||
| 3'UTR of PAQR5 (miRNA target sites are highlighted) |
>PAQR5|NM_001104554|3'UTR 1 CTCAGACCATAAGCTTTTCATGCCAGATGTCAACATTAAGCTGCAACATCCTAACCACCATAAGCCGGAGGTGGTTACAG 81 CTTATCATGGCCTAAAATATTCATAATGGTTGGTGTCTTTTGAATGAATTCATGTCAAAAATGTTATTCAGCTGGGGAAA 161 TTTCTCTAAATGTACACTGATTCTGTGTGTGTGATTTTAAAAGGAGAATATGGTTCAAGCAAGTCCTTGTTAAGGCAAAC 241 TATTGATATTTCATTAATTTTAAATTTACTTAAAATGTGGTTTTAAATTCTATTTAAACATTTGGATTAAGCATATTACT 321 CTGGAGCTTTGTATTATTCTTTAAAAATGAATCTTGCTTCATTTGATGAATTTCATGTCACAAAGCTTCTCTCAAGAGCT 401 CTCGTAGTGGCCTGTCAACCACTTTCGGAGAATGAGCCAGGTCAGTCACTGGGAGGACCTGTGAAAGAAAGTTGGTCACT 481 GAGTGCCTTGGGGACTGGCAAAACATTCCAGAATGAAGAGAGCTGTCTGGGGAGAGCCCTTCTTCCCTTCTCCACCTAGT 561 GAAGGGAGAACAGAAGGGGAGTCCTCTCTTCCCACAAGTCCATTCTGCCTTCAAAGTGTAAGTTCTCATGTCATTATGGA 641 TTTGGAGTTTGTCAGTTTTTTTCTTAAAAGTCCACAGCGGGGTGTCATGTGTTCTGTTATGTTCTGTTTTCTGGTTGCCA 721 GTTTGATCTGCAAAGTATTTTTCAGTGCAGGTAAAATGTGTTAAACCATAAGAGTTGACTGAGTTAATCCCAATTGGTTG 801 TGCTCATATGCCACCTTTTAAACCAATGGAAATTGCTATATTTGGGGATGTCATACATTTGATATTGCTTCAGCATTTCA 881 AATATGTTGCAAAATTTAGTATCCATATGCATAAGAAGTTAATCACCTTGCCAGTGGGGTGGTCACATATAGTGTTCTCA 961 AGCTTTACTGTGAATCAGAAACATCCAGTAAGCTTGTGACAAATGCAGACTCCTAGGGAAAACCAGGGGGTTCTGCTTCA 1041 CTAGGTTAAATGTAGGTTTTGTAGAGGAGATCTGCACTGGAGCAAGTCTCCCAGATGATTCTAATACAGGAGGGCCAGAG 1121 GCCAAACTTGAAGAACTGCTGGTGTTACATGTTCCAAAAGGCATTAGACCTATCAGCTTTGTTTCGCCTGATCTCAAGTT 1201 TTAGCAACTCACCAACTAAGGCGTAACCTCATTTTATGTTCCAGCGTTTTCTACTCTGAATAGTTCTAAAACACTGAGCA 1281 TTTTCTCATTTGTTGCATTACTGATTAAAGTTCAGTATTTCATGGTGTTTTCAGGGAACACAGAAATGCGGATGCAAAAC 1361 AACTTTTGACAGAGGCCCATCAAACCCAGATCTGCACTTGGTAATGACTTAGGGGGGCTTCCTCACAATGCAGGATCCTC 1441 TTTGCTGACTCAGGAATACTCCATATTTTAGACTACTGCCTCTACCATTAACTAGCCCAGACATTTGAATGGCCTTGTAA 1521 ACAGCTCACTGTCTAATACTCGAAGGACAAGTAACAATTTATATTGGATGAGAGTGGTCAAGAAATATGATTTCGTTAGT 1601 TTTATTATCTGTTTACTTCCTCTGGGGAAGGCAGACTGATAAAATTATATGGGCTGGTAAATTTTTGGTACATTAATTGC 1681 AAGCTGCATGACAAAATTTGTTTTTCTGGCAACAATCTGACATTATTAGTGGAATTCCACACCAACAGGGCTTGTGAGCT 1761 TCCATTTCATCTTACTGTAACTTCAATTTTATGGCAAAAAAAGGTACAAAGTTTAAATACCCCTTTCTAGTAATGCCAAA 1841 GACATACAGTGTTTTACATTCTCTCCTTTATAGGTAACAAAATAATGTTTAGCTCAGTAAGTACTGAAATAATGAGTGAC 1921 CAATTTGAAGGATTTTTAGATTATTTAATCTTTGCTTATGTTGCTTTTTCACATGCTTAATGATGGAAATGAAATGTTAA 2001 ATCAACAAAATAAGATCCAGTGTTTCATAACATTTTTATAAGTTTGGTAAACTTTAGTCCCATTATATACTTTTGGGGAC 2081 AGTGTTATAAATCAGAATTTTACGACAGTTTGCAGAACACTGATTTGAAAGCTTCCTATGCAAAATGAGAAGGGGTTCAA 2161 ATATATTAATTATCATTAAGTATTAAATAATAGGCATTAGATGTCTAATGTGAGTATAATTTCATCCAAGCCATCTCAGA 2241 AAGTCTAAAAGGTTGGCAGGGGGTCAGCTGAAGACCTCACTGGAGTGGGTCTTAATTTTTAAAAAGTGTCTCACTACATT 2321 TAAGACATGTGACACATTCCCATTGGTAACAATTGCTCACCATGGCATTGTCTCAAAAAAGACTATGGTGGGGAGGGTGG 2401 CACATTCCTAATGGGATGTACCTCTCCCCACTCCCCTTGCTTGAGAAGCACTACTCAAAAATTTACCAGACCTTACAACT 2481 GTGATAAAACTTGAATGTGTATGATGAATAAGGCCATTCAGTTAACTTTACCTCCCTTTACCCATTGAAGGGGTTCCTTT 2561 TCCATTGCTCAGTTTTTAGAAAATAATTCTCATCTTTTTTCTAAAGAAATGAATTTGTGGCTGGTCTGAAGGTAGTGAGT 2641 TAGCTCAATTGATTGTTCGCAGTCAGTTATAGATCAAGCTCCTTGTTCTACTCTTCCCCTCTTCTCACTACTGCACTTGA 2721 CTAGTCTTAAAACAAAGAAAGAACGAATGAATGAATGAATCTGTGGCTGGATGCAGTGGCTCATGCCTGTAATCCCAGCA 2801 CTTTGGGAGGCTGAAGTGGGAGGACTGCTTGGGCCCAAGAATTCAGGACCAGTCTGGGCAACAGAGCCAGACACTGTCTC 2881 TATAAAAAAAAGTTAAAACTAGCTGGTTGTGGTGGTGCACACCTGTGGTCCCAGCTACTGTGGAGGGTGATGTGGGAGGA 2961 TTGCTTGAACCCAGGAGTTGGATGCTGCAGTGAGCTATGATTGCGCCATTGCGCTCCAGACTGGGCAACAGGGCAAGACC 3041 CTGCCTCAAAAAAAAAAAAAAAAGAATTTGTAATTGTTGGTAGGATGTTATGGGAAATTTAGAGGTCTTCTGAGTATAAA 3121 GTGGTTTAAATATTTGGTCTGCTGAAGTCTTTCTGGAAGTGTTGTTCCCCCTGCTGCCCCGCCCAGTAGAAACTTGCTCA 3201 TATGAGAGGTTCTGAGGTAGGTGCGGTGTAGTAGAATGGCATTGTCAGATATGTTCAAGAAACCCTTCATTTGACACTAT 3281 TTTGTACCTTATGGTACCCTTTAACATTTTTTAATTAAAAAAAATATTTTTTGAGACAGGGTCTTGTTCTGTTGCCCAGG 3361 CTGGAGTGTAGTGTTGCAATCTTGGCTCACTGCAACCTCTGCCTGACAGGCTTCAGTGATCTTTCCACCTCAGCCTCCTG 3441 AGTAGCTGGGACTACAGGTGCATGCCACCAAGCCTGGCTAACTTTTTGTAGAGATAGGGTTTTGCCATGCTGCCCAGGCT 3521 GGCTTAGAATTCCTGAATTCAAGTGATTTGTCTGCCTCAGGCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACACTGC 3601 ACCCAGTCCATGCTACCCTTTTTATATGAAACACCTATTAACACGGTACAACAACACTTCAAAACATATTATTTGAATTT 3681 CGGCCTCTGATTTTCTAGTCAACAATCCATTAAGGCAAAGACCTGTTTCCAAACTCAGATGTTCTCCAACTTACACTAAT 3761 GTCTGGTTTTCTTGAACTATGTGAGAGAAAAAAATAAACAGAATTTATTTATTATAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 54852.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | BCBL-1 , BC-3 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1015448. RNA binding protein: AGO2. Condition:BCBL-1 mRNA
HITS-CLIP data was present in GSM1015449. RNA binding protein: AGO2. Condition:BC-3 mRNA
... - Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al., 2012, PLoS pathogens. |
| Article |
- Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al. - PLoS pathogens, 2012
KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.
LinkOut: [PMID: 22927820]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Hela |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
| Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 54852.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 , TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293/HeLa |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells)
HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells)
... - Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology. |
| Article |
- Kishore S; Gruber AR; Jedlinski DJ; Syed et al. - Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
|
| Experimental Support 8 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 9 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MDA-MB-231 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1395171. RNA binding protein: AGO. Condition:MDA-MB-231 AGO HITS-CLIP Replicate 3
... - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment. |
| Article |
- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al. - Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
|
| Experimental Support 10 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7
PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10
PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10
PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12
PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2
PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 11 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
PAR-CLIP data was present in SRX1760618. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_B
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| Experimental Support 12 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Cardiac Tissues |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202480. RNA binding protein: AGO2. Condition:S5_LV_36yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202477. RNA binding protein: AGO2. Condition:S2_LV_25yo_Male_AGO2_bound_RNA
... - Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research. |
| Article |
Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP.
- Spengler RM; Zhang X; Cheng C; McLendon JM; et al.- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
|
| CLIP-seq Support 1 for dataset GSM4850315 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / AGO_CLIP_Rep1 |
| Location of target site | NM_001104554 | 3UTR | CUUCUCACUACUGCACUUGACUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM4850316 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / AGO_CLIP_Rep2 |
| Location of target site | NM_001104554 | 3UTR | UUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM4850317 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / miRNA_WT |
| Location of target site | NM_001104554 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM4850318 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Zika virus infected neural stem cells / miRNA_H41R |
| Location of target site | NM_001104554 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 33718276 / GSE159916 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM714643 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1015448 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | BCBL-1 / BCBL-1 mRNA |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22927820 / GSE41357 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1015449 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | BC-3 / BC-3 mRNA |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22927820 / GSE41357 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1048188 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23313552 / GSE42701 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM1067869 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (asynchronous cells) |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23706177 / GSE43666 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM1067870 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (mitotic cells) |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23706177 / GSE43666 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 12 for dataset GSM1395171 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | MDA-MB-231 / MDA-MB-231 AGO HITS-CLIP Replicate 3 |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24906430 / GSE57855 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 13 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000395407.2 | 3UTR | CUACUCUUCCCCUCUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 14 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 15 for dataset GSM545215 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO4 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 16 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 17 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGUCUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 18 for dataset GSM714646 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repA |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCCCCUCUUCUCACUACUGCACUUGACUAGUCUUAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 19 for dataset GSM714647 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repB |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCCCCUCUUCUCACUACUGCACUUGACUAGUCUUAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 20 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCUCACUACUGCACUUGACUAGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 21 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000395407.2 | 3UTR | CUUCCCCUCUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 22 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000395407.2 | 3UTR | CCUCUUCUCACUACUGCACUUGACUAGUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 23 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000395407.2 | 3UTR | GUUCUACUCUUCCCCUCUUCUCACUACUGCACUUGACUAGUCUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 24 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000395407.2 | 3UTR | AGCUCCUUGUUCUACUCUUCCCCUCUUCUCACUACUGCACUUGACUAGUCUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
63 hsa-miR-921 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT054764 | ANGPTL1 | angiopoietin like 1 |  |
|
|
3 | 1 | |||||
| MIRT066171 | PIP4K2C | phosphatidylinositol-5-phosphate 4-kinase type 2 gamma | |
|
2 | 2 | ||||||
| MIRT069409 | ZFYVE21 | zinc finger FYVE-type containing 21 | |
|
2 | 8 | ||||||
| MIRT102284 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | |
|
2 | 4 | ||||||
| MIRT107595 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | |
|
2 | 6 | ||||||
| MIRT178618 | HIAT1 | major facilitator superfamily domain containing 14A | |
|
2 | 2 | ||||||
| MIRT182407 | TIPRL | TOR signaling pathway regulator | |
|
2 | 4 | ||||||
| MIRT186552 | ZBTB18 | zinc finger and BTB domain containing 18 | |
|
2 | 2 | ||||||
| MIRT273662 | HOXC8 | homeobox C8 | |
|
2 | 2 | ||||||
| MIRT283191 | C16ORF52 | chromosome 16 open reading frame 52 | |
|
2 | 2 | ||||||
| MIRT284890 | NFAT5 | nuclear factor of activated T-cells 5 | |
|
2 | 2 | ||||||
| MIRT347670 | LSM14A | LSM14A, mRNA processing body assembly factor | |
|
2 | 2 | ||||||
| MIRT400222 | SLC35F6 | solute carrier family 35 member F6 | |
|
2 | 2 | ||||||
| MIRT403517 | ASPH | aspartate beta-hydroxylase | |
|
2 | 2 | ||||||
| MIRT442251 | DCTN5 | dynactin subunit 5 | |
|
2 | 2 | ||||||
| MIRT443023 | SDR39U1 | short chain dehydrogenase/reductase family 39U member 1 | |
|
2 | 2 | ||||||
| MIRT443097 | RNF20 | ring finger protein 20 | |
|
2 | 2 | ||||||
| MIRT444560 | TRA2B | transformer 2 beta homolog | |
|
2 | 2 | ||||||
| MIRT445696 | PRKG1 | protein kinase, cGMP-dependent, type I | |
|
2 | 2 | ||||||
| MIRT454084 | TMEM209 | transmembrane protein 209 | |
|
2 | 2 | ||||||
| MIRT455463 | LYPLA2 | lysophospholipase II | |
|
2 | 2 | ||||||
| MIRT456653 | TIFA | TRAF interacting protein with forkhead associated domain | |
|
2 | 2 | ||||||
| MIRT458147 | LYRM4 | LYR motif containing 4 | |
|
2 | 6 | ||||||
| MIRT467073 | SRRD | SRR1 domain containing | |
|
2 | 4 | ||||||
| MIRT467245 | SPPL2A | signal peptide peptidase like 2A | |
|
2 | 2 | ||||||
| MIRT468246 | SFXN4 | sideroflexin 4 | |
|
2 | 2 | ||||||
| MIRT471589 | PAQR5 | progestin and adipoQ receptor family member 5 | |
|
2 | 19 | ||||||
| MIRT476639 | G2E3 | G2/M-phase specific E3 ubiquitin protein ligase | |
|
2 | 2 | ||||||
| MIRT482433 | ADM | adrenomedullin | |
|
2 | 10 | ||||||
| MIRT486848 | PERP | PERP, TP53 apoptosis effector | |
|
2 | 6 | ||||||
| MIRT489656 | SHMT1 | serine hydroxymethyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT493441 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | |
|
2 | 6 | ||||||
| MIRT493841 | FOXN3 | forkhead box N3 | |
|
2 | 4 | ||||||
| MIRT501378 | RBFOX2 | RNA binding protein, fox-1 homolog 2 | |
|
2 | 10 | ||||||
| MIRT509679 | ATAD5 | ATPase family, AAA domain containing 5 | |
|
2 | 4 | ||||||
| MIRT510280 | MED28 | mediator complex subunit 28 | |
|
2 | 2 | ||||||
| MIRT512221 | ATXN3 | ataxin 3 | |
|
2 | 6 | ||||||
| MIRT514030 | BNIP2 | BCL2 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT521375 | RDX | radixin | |
|
2 | 4 | ||||||
| MIRT521444 | RAD51 | RAD51 recombinase | |
|
2 | 2 | ||||||
| MIRT526055 | CBR1 | carbonyl reductase 1 | |
|
2 | 2 | ||||||
| MIRT528658 | FUNDC2 | FUN14 domain containing 2 | |
|
2 | 2 | ||||||
| MIRT529975 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | |
|
2 | 2 | ||||||
| MIRT544098 | IPMK | inositol polyphosphate multikinase | |
|
2 | 2 | ||||||
| MIRT545579 | SNRPA1 | small nuclear ribonucleoprotein polypeptide A' | |
|
2 | 2 | ||||||
| MIRT547424 | MED4 | mediator complex subunit 4 | |
|
2 | 2 | ||||||
| MIRT548955 | CD2AP | CD2 associated protein | |
|
2 | 2 | ||||||
| MIRT549537 | NDUFA6 | NADH:ubiquinone oxidoreductase subunit A6 | |
|
2 | 4 | ||||||
| MIRT552550 | ZFP36L2 | ZFP36 ring finger protein like 2 | |
|
2 | 4 | ||||||
| MIRT554640 | ROBO1 | roundabout guidance receptor 1 | |
|
2 | 2 | ||||||
| MIRT564904 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | |
|
2 | 2 | ||||||
| MIRT565578 | SLC6A8 | solute carrier family 6 member 8 | |
|
2 | 2 | ||||||
| MIRT568312 | BAG4 | BCL2 associated athanogene 4 | |
|
2 | 2 | ||||||
| MIRT617891 | PTCHD3 | patched domain containing 3 | |
|
2 | 2 | ||||||
| MIRT621892 | TAF13 | TATA-box binding protein associated factor 13 | |
|
2 | 2 | ||||||
| MIRT642850 | RNF135 | ring finger protein 135 | |
|
2 | 2 | ||||||
| MIRT665395 | WEE1 | WEE1 G2 checkpoint kinase | |
|
2 | 2 | ||||||
| MIRT697879 | UBE2B | ubiquitin conjugating enzyme E2 B | |
|
2 | 2 | ||||||
| MIRT698492 | THOC2 | THO complex 2 | |
|
2 | 2 | ||||||
| MIRT701227 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | |
|
2 | 2 | ||||||
| MIRT701872 | MPLKIP | M-phase specific PLK1 interacting protein | |
|
2 | 2 | ||||||
| MIRT707045 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | |
|
2 | 2 | ||||||
| MIRT715216 | NPVF | neuropeptide VF precursor | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|