pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-642b |
Genomic Coordinates | chr19: 45674932 - 45675008 |
Description | Homo sapiens miR-642b stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-642b-3p | |||||||||||||||||||||||||||
Sequence | 47| AGACACAUUUGGAGAGGGACCC |68 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | OXR1 | ||||||||||||||||||||
Synonyms | Nbla00307, TLDC3 | ||||||||||||||||||||
Description | oxidation resistance 1 | ||||||||||||||||||||
Transcript | NM_018002 | ||||||||||||||||||||
Other Transcripts | NM_181354 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on OXR1 | |||||||||||||||||||||
3'UTR of OXR1 (miRNA target sites are highlighted) |
>OXR1|NM_018002|3'UTR 1 ATAAAATGCTCTCTGTCTTAGCAGGAGAATGGCCCAAACCTGACATGGACAAGCATTGTTTGGAAAGTTCAAGAAGCAAT 81 ACAGTGTAACATGTCACTTGTGCTTTAAAATTAGTCTGTATCACCATTTATTACAGTTATAATTTTGGAGTTTATTTTTC 161 AAATCATGTTCTTGTCCCAGAGTTCTTTAGGTTAACACTAGGGACTGCGTCCATGTACTAGTATAACAGCTTGGGTTTGT 241 TAGAATTTGGGCAACATTTTGATTATAATGACAACTTCATTTTCACATGTTACTCAGTTCCCTAATAGGATGGTGCTCTT 321 TTGTTGAACCTGTATTGATTTTTTTTTTTTTAACTATATTGATTCGTTTACTAGAACAGTCTAATTGGGGCATTGAGGAA 401 ATGAAGACTGGATACTTCTGTATCTGTGAAGTTGGCACAGGTAACATTTGGACATGTTCATCTTATTCTTAGGAAGGAAA 481 AAATCACTTGCCAAAATAATACATACTTCATAGACCACTGAGTTCTAGTTTTTATTCACACTACAACATTCTCTTTAACG 561 ATGTTGCAGGTATTCTCAATTTCCTTTTAAGAAAAATGAAATGTGAGGAGAATTCTGGTTGTAATAGATGACAGTACATA 641 TGATCTGCAGGTTTGGGCATATGCTTTCATCATTAAATTATCTGATAAAGTTACAAGTCACAAAGGAGAATGAGAACTTA 721 ATGATTCTATTGGATTTAATATATTAGCAAGAAAACATACTATTTACATATGTGTAGCTTAGTAAGGCATTAACATAAGT 801 ACAAAAACTATGAAACAGATGCATATTTCCTCAACATACTGTGTCAGGTATACTGTTTTATAATTTGGTTGTTTTAGCCT 881 TATTGCACACCAACTCCCAAAATATAGGTTACTCTTGTTCAAAAGGAAAAAAAAAATTGTGATTTTCTTTGAGTGGTATA 961 TGTTATTAATTACCATTAGCATTTGCTCTTATAAAGGGCAATGATTATAGTAGACAATATTGTAACTCAGTAGACTTGTT 1041 GAATATGCAAACTTACTGTCAAGTGACCTCAAAAAAAAAATGAAAAGATAGAATACACTAGTAGTTCTTATCCTCTTTTG 1121 TAGGAAACCAATAATAGCCATTGTGGCAATAATTCATCAGTTGATTTTAAAGCTTCATGTTATGCAAAAAAGAATCCTGC 1201 TGTTATACATGTGACAGTGACTTTGTGCTGAAATTTCAGCTATTCCAGATAAACATTGTATATCTTGTAAATTAATGTTT 1281 AAAGGTGTAGTTTTGTTCTTACAGAAAGTGTTGATTGCCAGGTTGCTTATAGCACTTTAAGTTATTCTAAAAATGAAATT 1361 ATAAGCCAAATATTTGGCTTAAGTAGATTTAGTTGTATAGCACTTACATATTTAGTTCTTTTGAAAGTTTAGATAATTAT 1441 TTAAAGAAAGCATAATGCTAATGGAAAAGAAAATCTGATGTTCTATTATAATATGCTATTGCTGAATATGAATAGAAATA 1521 CAGGGCATCATTTCCTTGTCTCATTATAAGTTAGTAACAATATATAGATTAAATGTTTACAATATAGGGAATTGTAAATA 1601 AATATATCAGTTTTTTTCCCCTTCGGTCTTCCACAGCAGTATTATTGTCTTTGTGGAGTTGACTAATGATAATTTAAAAA 1681 TCCTGTAATGGATTTCTACTAAAATAAGGTCATAGTGGCATATACCAAATAAAATCAAATACAGAAATACAAAAAAAAAA 1761 AAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000312046.6 | 3UTR | CAUAUUUCCUCAACAUACUGUGUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
77 hsa-miR-642b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT082888 | ZNF543 | zinc finger protein 543 | 2 | 2 | ||||||||
MIRT108294 | BHLHB9 | basic helix-loop-helix family member b9 | 2 | 2 | ||||||||
MIRT348737 | ZNF350 | zinc finger protein 350 | 2 | 2 | ||||||||
MIRT381384 | EXOG | exo/endonuclease G | 2 | 2 | ||||||||
MIRT452245 | TRAM1 | translocation associated membrane protein 1 | 2 | 2 | ||||||||
MIRT459262 | ADRBK1 | G protein-coupled receptor kinase 2 | 2 | 2 | ||||||||
MIRT468117 | SH3PXD2A | SH3 and PX domains 2A | 2 | 2 | ||||||||
MIRT468402 | SETD3 | SET domain containing 3 | 2 | 2 | ||||||||
MIRT469079 | RNF168 | ring finger protein 168 | 2 | 2 | ||||||||
MIRT471690 | OXR1 | oxidation resistance 1 | 2 | 2 | ||||||||
MIRT477353 | EOGT | EGF domain specific O-linked N-acetylglucosamine transferase | 2 | 4 | ||||||||
MIRT479600 | CDC25B | cell division cycle 25B | 2 | 2 | ||||||||
MIRT482377 | AFF4 | AF4/FMR2 family member 4 | 2 | 4 | ||||||||
MIRT484029 | LARP4B | La ribonucleoprotein domain family member 4B | 2 | 2 | ||||||||
MIRT490988 | USP22 | ubiquitin specific peptidase 22 | 2 | 2 | ||||||||
MIRT493250 | MEF2D | myocyte enhancer factor 2D | 2 | 2 | ||||||||
MIRT493850 | FOXN3 | forkhead box N3 | 2 | 4 | ||||||||
MIRT496086 | C17orf85 | nuclear cap binding subunit 3 | 2 | 2 | ||||||||
MIRT500630 | TXNIP | thioredoxin interacting protein | 2 | 2 | ||||||||
MIRT501048 | SMEK1 | protein phosphatase 4 regulatory subunit 3A | 2 | 2 | ||||||||
MIRT525186 | ZNF257 | zinc finger protein 257 | 2 | 4 | ||||||||
MIRT534875 | QSER1 | glutamine and serine rich 1 | 2 | 2 | ||||||||
MIRT539336 | AGPAT5 | 1-acylglycerol-3-phosphate O-acyltransferase 5 | 2 | 2 | ||||||||
MIRT553814 | SYNCRIP | synaptotagmin binding cytoplasmic RNA interacting protein | 2 | 2 | ||||||||
MIRT555959 | NRAS | NRAS proto-oncogene, GTPase | 2 | 2 | ||||||||
MIRT556289 | MAP3K5 | mitogen-activated protein kinase kinase kinase 5 | 2 | 2 | ||||||||
MIRT561212 | ZSWIM1 | zinc finger SWIM-type containing 1 | 2 | 2 | ||||||||
MIRT567328 | HMGB1 | high mobility group box 1 | 2 | 2 | ||||||||
MIRT572385 | LRRC6 | leucine rich repeat containing 6 | 2 | 2 | ||||||||
MIRT575529 | Map4 | microtubule-associated protein 4 | 2 | 2 | ||||||||
MIRT575684 | Map1b | microtubule-associated protein 1B | 2 | 2 | ||||||||
MIRT576828 | Tgfbr3 | transforming growth factor, beta receptor III | 2 | 2 | ||||||||
MIRT576953 | Pigs | phosphatidylinositol glycan anchor biosynthesis, class S | 2 | 3 | ||||||||
MIRT608316 | SYK | spleen associated tyrosine kinase | 2 | 4 | ||||||||
MIRT609794 | PINX1 | PIN2/TERF1 interacting telomerase inhibitor 1 | 2 | 2 | ||||||||
MIRT609991 | PIGS | phosphatidylinositol glycan anchor biosynthesis class S | 2 | 3 | ||||||||
MIRT611381 | PNMAL1 | paraneoplastic Ma antigen family member 8A | 2 | 4 | ||||||||
MIRT613566 | YY2 | YY2 transcription factor | 2 | 2 | ||||||||
MIRT614612 | MVK | mevalonate kinase | 2 | 2 | ||||||||
MIRT615497 | MPP2 | membrane palmitoylated protein 2 | 2 | 2 | ||||||||
MIRT616941 | OTUD7A | OTU deubiquitinase 7A | 2 | 2 | ||||||||
MIRT617576 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | 2 | 2 | ||||||||
MIRT618214 | SPTLC3 | serine palmitoyltransferase long chain base subunit 3 | 2 | 4 | ||||||||
MIRT619885 | ABHD17B | abhydrolase domain containing 17B | 2 | 2 | ||||||||
MIRT620401 | MYO1H | myosin IH | 2 | 2 | ||||||||
MIRT620517 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | 2 | 2 | ||||||||
MIRT622166 | SMYD1 | SET and MYND domain containing 1 | 2 | 2 | ||||||||
MIRT623195 | MTX3 | metaxin 3 | 2 | 2 | ||||||||
MIRT623440 | KIAA0408 | KIAA0408 | 2 | 4 | ||||||||
MIRT624837 | ACAP2 | ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 | 2 | 2 | ||||||||
MIRT625706 | SHROOM1 | shroom family member 1 | 2 | 2 | ||||||||
MIRT628159 | HIP1 | huntingtin interacting protein 1 | 2 | 2 | ||||||||
MIRT629496 | SGIP1 | SH3 domain GRB2 like endophilin interacting protein 1 | 2 | 2 | ||||||||
MIRT630240 | SOGA3 | SOGA family member 3 | 2 | 4 | ||||||||
MIRT630521 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | 2 | 4 | ||||||||
MIRT635676 | COX18 | COX18, cytochrome c oxidase assembly factor | 2 | 4 | ||||||||
MIRT637820 | CACNA1B | calcium voltage-gated channel subunit alpha1 B | 2 | 2 | ||||||||
MIRT637943 | SIGLEC9 | sialic acid binding Ig like lectin 9 | 2 | 2 | ||||||||
MIRT640490 | EXOC5 | exocyst complex component 5 | 2 | 2 | ||||||||
MIRT642722 | ATXN3 | ataxin 3 | 2 | 2 | ||||||||
MIRT649153 | LRTM1 | leucine rich repeats and transmembrane domains 1 | 2 | 2 | ||||||||
MIRT649610 | ITPKC | inositol-trisphosphate 3-kinase C | 2 | 2 | ||||||||
MIRT661016 | ABCA12 | ATP binding cassette subfamily A member 12 | 2 | 2 | ||||||||
MIRT661055 | RPL18A | ribosomal protein L18a | 2 | 2 | ||||||||
MIRT684041 | FOLR1 | folate receptor 1 | 2 | 2 | ||||||||
MIRT691014 | CRTC3 | CREB regulated transcription coactivator 3 | 2 | 2 | ||||||||
MIRT698908 | SPPL2A | signal peptide peptidase like 2A | 2 | 2 | ||||||||
MIRT700981 | PDE4D | phosphodiesterase 4D | 2 | 2 | ||||||||
MIRT701722 | MTMR12 | myotubularin related protein 12 | 2 | 2 | ||||||||
MIRT702724 | INSIG1 | insulin induced gene 1 | 2 | 2 | ||||||||
MIRT705057 | C5orf15 | chromosome 5 open reading frame 15 | 2 | 2 | ||||||||
MIRT705216 | BRWD1 | bromodomain and WD repeat domain containing 1 | 2 | 2 | ||||||||
MIRT706088 | HNRNPU | heterogeneous nuclear ribonucleoprotein U | 2 | 2 | ||||||||
MIRT709458 | KRTAP19-1 | keratin associated protein 19-1 | 2 | 2 | ||||||||
MIRT711396 | RANBP2 | RAN binding protein 2 | 2 | 2 | ||||||||
MIRT720573 | SDHAF2 | succinate dehydrogenase complex assembly factor 2 | 2 | 2 | ||||||||
MIRT725366 | MTF2 | metal response element binding transcription factor 2 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|