pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6871 |
Genomic Coordinates | chr20: 41169023 - 41169078 |
Description | Homo sapiens miR-6871 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6871-3p | |||||||||||||||||||||||||||
Sequence | 35| CAGCACCCUGUGGCUCCCACAG |56 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
|||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NASP | ||||||||||||||||||||
Synonyms | FLB7527, HMDRA1, PRO1999 | ||||||||||||||||||||
Description | nuclear autoantigenic sperm protein | ||||||||||||||||||||
Transcript | NM_002482 | ||||||||||||||||||||
Other Transcripts | NM_152298 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on NASP | |||||||||||||||||||||
3'UTR of NASP (miRNA target sites are highlighted) |
>NASP|NM_002482|3'UTR 1 GAGGGGGCACAGCCCTCCTCCCAAGGGAAAGTGTTTTTGTATATAATGTATTTTTTCACTTTTGGAGGATTCTTTTTGTA 81 TAACTTCAATAAAGATTGTAAGCAAAGGTTGAGGCTTTGATGGTTTTTTTCTTAATTATTGGCTGAATCTGCCTTGGAGC 161 ACTGCTGGTTTTATATATTAGCCAAAGGTTTTGTTCTGGCCTTCTGTACTGATCTGTGTTCCTGATCCTAATTCCTATCT 241 GTCTAACGTGGAGGTGATCAAGTGTGGCTGTAGGCCTTTGTTTTCCAATGGTGCTATATTCTGTTTTCAAACACTTCACT 321 GAACCCAGCTGTCTTGCAAACTTTCAGTGGTGCTGTCCCTGGATGGGGGCTACAAAAACAAGAATTGGTGAAGATCTTGC 401 TCTTCAGTGCTGAAAATGGATGATGGACTTTGGCTGTGAGCCAGGCCTAGGATGGTTCTTGTCCTATATCCACCTAGTCT 481 TCACCTGGGGCTATAATTCTGTCCTGGAAAAAGAACTCTGAAAACCTGGGTCAGGGGAATGATTCCTAAGGAAAACGGTC 561 TGCATTTGAGCTCTGGTTTGAAAGTAGCCAAGGGGACTGATGGTGGACACTCCAGATGTGGTTGGAAGCATATGTGGGGA 641 GGCTGGCTGGTTGAGTTTTGTTATTTTCTGTATAGAAAGGTTGAGATATATCAACACTTGGAATTGTTACCCATCTGCAG 721 AATTGACTTCTCAAATAAAGATGCTAAAAATCTCCTTGTCTGGAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HCT116 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000350030.3 | 3UTR | UUUUCCAAUGGUGCUAUAUUCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
88 hsa-miR-6871-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT061678 | BTG2 | BTG anti-proliferation factor 2 | 2 | 4 | ||||||||
MIRT116181 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | 2 | 2 | ||||||||
MIRT150139 | MIDN | midnolin | 2 | 2 | ||||||||
MIRT197058 | NKIRAS2 | NFKB inhibitor interacting Ras like 2 | 2 | 2 | ||||||||
MIRT225108 | GOLGA7 | golgin A7 | 2 | 2 | ||||||||
MIRT376288 | CALM3 | calmodulin 3 | 2 | 2 | ||||||||
MIRT454810 | NEDD9 | neural precursor cell expressed, developmentally down-regulated 9 | 2 | 2 | ||||||||
MIRT464228 | VEGFA | vascular endothelial growth factor A | 2 | 6 | ||||||||
MIRT466961 | STAT3 | signal transducer and activator of transcription 3 | 2 | 2 | ||||||||
MIRT468219 | SGK1 | serum/glucocorticoid regulated kinase 1 | 2 | 2 | ||||||||
MIRT472460 | NASP | nuclear autoantigenic sperm protein | 2 | 2 | ||||||||
MIRT474203 | LEPRE1 | prolyl 3-hydroxylase 1 | 1 | 1 | ||||||||
MIRT475836 | HDGF | heparin binding growth factor | 2 | 4 | ||||||||
MIRT478667 | CTC1 | CST telomere replication complex component 1 | 2 | 14 | ||||||||
MIRT478707 | CSRNP2 | cysteine and serine rich nuclear protein 2 | 2 | 2 | ||||||||
MIRT478982 | COMMD2 | COMM domain containing 2 | 2 | 2 | ||||||||
MIRT479693 | CCNT2 | cyclin T2 | 2 | 6 | ||||||||
MIRT488440 | ULBP2 | UL16 binding protein 2 | 2 | 2 | ||||||||
MIRT492511 | RAET1L | retinoic acid early transcript 1L | 2 | 2 | ||||||||
MIRT492975 | NCS1 | neuronal calcium sensor 1 | 2 | 2 | ||||||||
MIRT494158 | COL4A1 | collagen type IV alpha 1 chain | 2 | 6 | ||||||||
MIRT495934 | SLC7A5P2 | solute carrier family 7 member 5 pseudogene 2 | 2 | 2 | ||||||||
MIRT496210 | PLEKHG2 | pleckstrin homology and RhoGEF domain containing G2 | 2 | 2 | ||||||||
MIRT496356 | PPY | pancreatic polypeptide | 2 | 2 | ||||||||
MIRT496385 | ZC3H6 | zinc finger CCCH-type containing 6 | 2 | 2 | ||||||||
MIRT496463 | DCTN5 | dynactin subunit 5 | 2 | 2 | ||||||||
MIRT497642 | GLDN | gliomedin | 2 | 2 | ||||||||
MIRT498496 | FRK | fyn related Src family tyrosine kinase | 2 | 2 | ||||||||
MIRT501928 | MCL1 | MCL1, BCL2 family apoptosis regulator | 2 | 8 | ||||||||
MIRT513286 | PDPK1 | 3-phosphoinositide dependent protein kinase 1 | 2 | 2 | ||||||||
MIRT514767 | RBM4B | RNA binding motif protein 4B | 2 | 2 | ||||||||
MIRT514916 | MDM2 | MDM2 proto-oncogene | 2 | 6 | ||||||||
MIRT515669 | LRRC27 | leucine rich repeat containing 27 | 2 | 2 | ||||||||
MIRT520367 | UBE2G2 | ubiquitin conjugating enzyme E2 G2 | 2 | 2 | ||||||||
MIRT523960 | DYNLT1 | dynein light chain Tctex-type 1 | 2 | 4 | ||||||||
MIRT526859 | KIFC1 | kinesin family member C1 | 2 | 2 | ||||||||
MIRT527673 | CASP8 | caspase 8 | 2 | 2 | ||||||||
MIRT527828 | TMEM74B | transmembrane protein 74B | 2 | 2 | ||||||||
MIRT529553 | EI24 | EI24, autophagy associated transmembrane protein | 2 | 2 | ||||||||
MIRT530547 | SYNPO | synaptopodin | 2 | 2 | ||||||||
MIRT531725 | TARS | threonyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT533340 | UNC119B | unc-119 lipid binding chaperone B | 2 | 2 | ||||||||
MIRT533620 | TNFRSF13C | TNF receptor superfamily member 13C | 2 | 2 | ||||||||
MIRT537226 | GAN | gigaxonin | 2 | 2 | ||||||||
MIRT544430 | ZNF460 | zinc finger protein 460 | 2 | 4 | ||||||||
MIRT546905 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | 2 | 2 | ||||||||
MIRT547102 | PLAG1 | PLAG1 zinc finger | 2 | 2 | ||||||||
MIRT547820 | ISG20L2 | interferon stimulated exonuclease gene 20 like 2 | 2 | 2 | ||||||||
MIRT548236 | FEM1B | fem-1 homolog B | 2 | 2 | ||||||||
MIRT550034 | WWTR1 | WW domain containing transcription regulator 1 | 2 | 2 | ||||||||
MIRT554337 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | 2 | 4 | ||||||||
MIRT565483 | SPRTN | SprT-like N-terminal domain | 2 | 2 | ||||||||
MIRT568200 | CBX6 | chromobox 6 | 2 | 2 | ||||||||
MIRT569754 | C2orf71 | chromosome 2 open reading frame 71 | 2 | 2 | ||||||||
MIRT571369 | ZNF45 | zinc finger protein 45 | 2 | 2 | ||||||||
MIRT609886 | CLASP1 | cytoplasmic linker associated protein 1 | 2 | 4 | ||||||||
MIRT640543 | C3orf36 | chromosome 3 open reading frame 36 | 2 | 2 | ||||||||
MIRT640885 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | 2 | 2 | ||||||||
MIRT643494 | LRCH3 | leucine rich repeats and calponin homology domain containing 3 | 2 | 2 | ||||||||
MIRT643627 | YY2 | YY2 transcription factor | 2 | 2 | ||||||||
MIRT644384 | ZNF286A | zinc finger protein 286A | 2 | 2 | ||||||||
MIRT646126 | SLC26A9 | solute carrier family 26 member 9 | 2 | 2 | ||||||||
MIRT655939 | NDUFA4P1 | NDUFA4, mitochondrial complex associated pseudogene 1 | 2 | 2 | ||||||||
MIRT656057 | MYLK4 | myosin light chain kinase family member 4 | 2 | 2 | ||||||||
MIRT658767 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | 2 | 2 | ||||||||
MIRT661583 | EPHX2 | epoxide hydrolase 2 | 2 | 2 | ||||||||
MIRT664285 | RNMTL1 | mitochondrial rRNA methyltransferase 3 | 2 | 2 | ||||||||
MIRT689391 | ZNF850 | zinc finger protein 850 | 2 | 2 | ||||||||
MIRT694530 | TRIM72 | tripartite motif containing 72 | 2 | 2 | ||||||||
MIRT694626 | ZFPM1 | zinc finger protein, FOG family member 1 | 2 | 2 | ||||||||
MIRT695133 | PRY2 | PTPN13-like, Y-linked 2 | 2 | 2 | ||||||||
MIRT695150 | PRY | PTPN13-like, Y-linked | 2 | 2 | ||||||||
MIRT697468 | ZC3H4 | zinc finger CCCH-type containing 4 | 2 | 2 | ||||||||
MIRT701919 | MLXIP | MLX interacting protein | 2 | 2 | ||||||||
MIRT704548 | CNBP | CCHC-type zinc finger nucleic acid binding protein | 2 | 2 | ||||||||
MIRT704791 | CDK6 | cyclin dependent kinase 6 | 2 | 2 | ||||||||
MIRT705696 | ANKRD13A | ankyrin repeat domain 13A | 2 | 2 | ||||||||
MIRT707992 | OTUD4 | OTU deubiquitinase 4 | 2 | 2 | ||||||||
MIRT708739 | FAM71F2 | family with sequence similarity 71 member F2 | 2 | 2 | ||||||||
MIRT713401 | FAM179A | TOG array regulator of axonemal microtubules 2 | 2 | 2 | ||||||||
MIRT713846 | FAM3D | family with sequence similarity 3 member D | 2 | 2 | ||||||||
MIRT716998 | ARL6IP4 | ADP ribosylation factor like GTPase 6 interacting protein 4 | 2 | 2 | ||||||||
MIRT718511 | DIRAS1 | DIRAS family GTPase 1 | 2 | 2 | ||||||||
MIRT718698 | BTBD9 | BTB domain containing 9 | 2 | 2 | ||||||||
MIRT719578 | TYRO3 | TYRO3 protein tyrosine kinase | 2 | 2 | ||||||||
MIRT720892 | CSGALNACT1 | chondroitin sulfate N-acetylgalactosaminyltransferase 1 | 2 | 2 | ||||||||
MIRT722633 | C8A | complement C8 alpha chain | 2 | 2 | ||||||||
MIRT723333 | DGAT1 | diacylglycerol O-acyltransferase 1 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|