>NASP|NM_002482|3'UTR
   1 GAGGGGGCACAGCCCTCCTCCCAAGGGAAAGTGTTTTTGTATATAATGTATTTTTTCACTTTTGGAGGATTCTTTTTGTA
  81 TAACTTCAATAAAGATTGTAAGCAAAGGTTGAGGCTTTGATGGTTTTTTTCTTAATTATTGGCTGAATCTGCCTTGGAGC
 161 ACTGCTGGTTTTATATATTAGCCAAAGGTTTTGTTCTGGCCTTCTGTACTGATCTGTGTTCCTGATCCTAATTCCTATCT
 241 GTCTAACGTGGAGGTGATCAAGTGTGGCTGTAGGCCTTTGTTTTCCAATGGTGCTATATTCTGTTTTCAAACACTTCACT
 321 GAACCCAGCTGTCTTGCAAACTTTCAGTGGTGCTGTCCCTGGATGGGGGCTACAAAAACAAGAATTGGTGAAGATCTTGC
 401 TCTTCAGTGCTGAAAATGGATGATGGACTTTGGCTGTGAGCCAGGCCTAGGATGGTTCTTGTCCTATATCCACCTAGTCT
 481 TCACCTGGGGCTATAATTCTGTCCTGGAAAAAGAACTCTGAAAACCTGGGTCAGGGGAATGATTCCTAAGGAAAACGGTC
 561 TGCATTTGAGCTCTGGTTTGAAAGTAGCCAAGGGGACTGATGGTGGACACTCCAGATGTGGTTGGAAGCATATGTGGGGA
 641 GGCTGGCTGGTTGAGTTTTGTTATTTTCTGTATAGAAAGGTTGAGATATATCAACACTTGGAATTGTTACCCATCTGCAG
 721 AATTGACTTCTCAAATAAAGATGCTAAAAATCTCCTTGTCTGGAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gacacccucggugucCCACGAc 5' |||||| Target 5' cctttgttttccaatGGTGCTa 3'	275 - 296	120.00	-13.20
2	miRNA 3' gacacccucggugucCCACGAc 5' |||||| Target 5' ttgcaaactttcagtGGTGCTg 3'	334 - 355	120.00	-17.40
3	miRNA 3' gacACCCUCGGU----GUCCCACGAc 5' || |||||| :||| || | Target 5' ggcTGTGAGCCAGGCCTAGGATGGTt 3'	432 - 457	105.00	-17.50

Mutant ID	Mutant Position	Mutant Source
COSN30479705	16	COSMIC
COSN20067965	131	COSMIC
COSN6457646	176	COSMIC
COSN20964131	205	COSMIC
COSN31526445	289	COSMIC
COSN15659917	391	COSMIC
COSN28578931	485	COSMIC
rs376271232	272	GWAS
rs1053941	571	GWAS

Mutant ID	Mutant Position	Mutant Source
rs569115850	1	dbSNP
rs763524267	4	dbSNP
rs766902004	9	dbSNP
rs1404705405	15	dbSNP
rs751892824	16	dbSNP
rs1342861898	22	dbSNP
rs755302780	25	dbSNP
rs201533946	28	dbSNP
rs1256840347	30	dbSNP
rs1484318941	32	dbSNP
rs912295281	33	dbSNP
rs1229579511	34	dbSNP
rs767645157	37	dbSNP
rs752950017	38	dbSNP
rs1183348450	44	dbSNP
rs756252138	46	dbSNP
rs1207400159	47	dbSNP
rs1265073840	49	dbSNP
rs1447458003	51	dbSNP
rs777795392	53	dbSNP
rs1329134617	57	dbSNP
rs996447371	69	dbSNP
rs1451690726	71	dbSNP
rs1044336400	73	dbSNP
rs187468787	74	dbSNP
rs999522698	79	dbSNP
rs1246389270	81	dbSNP
rs1050075805	82	dbSNP
rs889128260	84	dbSNP
rs943351341	90	dbSNP
rs1295380597	97	dbSNP
rs1319685994	103	dbSNP
rs1403150459	108	dbSNP
rs1163831718	109	dbSNP
rs768372275	115	dbSNP
rs1387453591	120	dbSNP
rs1187139243	123	dbSNP
rs1391462016	124	dbSNP
rs766565126	130	dbSNP
rs1381645265	131	dbSNP
rs1243248154	133	dbSNP
rs528856721	134	dbSNP
rs1367160579	137	dbSNP
rs1291229727	140	dbSNP
rs1247007458	143	dbSNP
rs776885815	144	dbSNP
rs547094616	147	dbSNP
rs893913877	149	dbSNP
rs1009603089	150	dbSNP
rs762693868	151	dbSNP
rs960765336	157	dbSNP
rs1314044787	158	dbSNP
rs1356839161	166	dbSNP
rs1246445435	167	dbSNP
rs1348806240	174	dbSNP
rs1021154857	176	dbSNP
rs763914139	178	dbSNP
rs751524673	181	dbSNP
rs1023486116	185	dbSNP
rs969586988	187	dbSNP
rs757130605	192	dbSNP
rs1034323840	194	dbSNP
rs767022190	194	dbSNP
rs1477049550	201	dbSNP
rs959040324	201	dbSNP
rs1268253449	203	dbSNP
rs983818293	205	dbSNP
rs1026857166	210	dbSNP
rs1246693146	215	dbSNP
rs1272819614	224	dbSNP
rs1203501814	226	dbSNP
rs1307893313	228	dbSNP
rs559361463	230	dbSNP
rs951075861	235	dbSNP
rs982400816	238	dbSNP
rs1366902346	240	dbSNP
rs1466609248	241	dbSNP
rs1283329075	242	dbSNP
rs1406293641	244	dbSNP
rs531745479	248	dbSNP
rs945178	249	dbSNP
rs1422293020	255	dbSNP
rs1167170932	256	dbSNP
rs1355495456	260	dbSNP
rs972470622	262	dbSNP
rs376271232	272	dbSNP
rs551499295	281	dbSNP
rs922133295	283	dbSNP
rs190702809	289	dbSNP
rs779622811	291	dbSNP
rs1429255729	292	dbSNP
rs985415278	295	dbSNP
rs1481474164	296	dbSNP
rs1156909166	304	dbSNP
rs1390773965	307	dbSNP
rs1435650666	312	dbSNP
rs1335846101	321	dbSNP
rs932133355	322	dbSNP
rs1481114135	332	dbSNP
rs911103442	346	dbSNP
rs935900127	348	dbSNP
rs1053751719	353	dbSNP
rs1003336118	359	dbSNP
rs776155300	364	dbSNP
rs879041616	365	dbSNP
rs1224768058	368	dbSNP
rs1326464224	381	dbSNP
rs1305779306	390	dbSNP
rs893799223	402	dbSNP
rs1312955002	403	dbSNP
rs904084084	404	dbSNP
rs183278062	406	dbSNP
rs1300233647	411	dbSNP
rs1446349825	414	dbSNP
rs1405935951	418	dbSNP
rs1226072139	432	dbSNP
rs1470960703	444	dbSNP
rs1409828344	447	dbSNP
rs1042826387	449	dbSNP
rs1052448109	450	dbSNP
rs549276839	459	dbSNP
rs1004091306	467	dbSNP
rs1209837368	468	dbSNP
rs187902758	472	dbSNP
rs534980916	475	dbSNP
rs1243607669	479	dbSNP
rs1205499080	481	dbSNP
rs1024105208	485	dbSNP
rs755320242	491	dbSNP
rs1183868083	494	dbSNP
rs1257087653	500	dbSNP
rs1418684202	511	dbSNP
rs895423948	514	dbSNP
rs1005803990	519	dbSNP
rs1382506766	520	dbSNP
rs1337865519	531	dbSNP
rs1455045268	546	dbSNP
rs1457767987	548	dbSNP
rs1016645506	552	dbSNP
rs1288337412	552	dbSNP
rs1357260313	554	dbSNP
rs779361634	557	dbSNP
rs905065300	558	dbSNP
rs1162950312	567	dbSNP
rs1053941	571	dbSNP
rs377582651	572	dbSNP
rs773679188	575	dbSNP
rs1289689233	576	dbSNP
rs951313657	583	dbSNP
rs993935892	584	dbSNP
rs772771532	586	dbSNP
rs1029804351	587	dbSNP
rs1205158121	592	dbSNP
rs1486582215	609	dbSNP
rs1350570081	610	dbSNP
rs1221302731	612	dbSNP
rs1229610219	613	dbSNP
rs1301161868	614	dbSNP
rs1246138780	625	dbSNP
rs1359790064	627	dbSNP
rs955249867	630	dbSNP
rs982642877	631	dbSNP
rs1325144586	634	dbSNP
rs796785271	636	dbSNP
rs1310853639	639	dbSNP
rs985728107	647	dbSNP
rs1387249099	655	dbSNP
rs1301438054	657	dbSNP
rs1424259777	660	dbSNP
rs773839451	662	dbSNP
rs1165215226	664	dbSNP
rs965384059	669	dbSNP
rs1193818635	671	dbSNP
rs1372393008	671	dbSNP
rs975225374	675	dbSNP
rs1429718895	681	dbSNP
rs1212722980	682	dbSNP
rs1198112679	684	dbSNP
rs71653970	686	dbSNP
rs932191146	688	dbSNP
rs957315405	689	dbSNP
rs771008412	690	dbSNP
rs1472943836	695	dbSNP
rs1251186212	696	dbSNP
rs776746879	707	dbSNP
rs1328775578	710	dbSNP
rs565028942	713	dbSNP
rs925410773	714	dbSNP
rs1423009787	724	dbSNP
rs1346335612	725	dbSNP
rs1305225163	733	dbSNP
rs375831985	733	dbSNP
rs945354889	733	dbSNP
rs1395527040	734	dbSNP
rs1176543875	737	dbSNP
rs1353640607	740	dbSNP
rs935587898	742	dbSNP
rs1198001303	744	dbSNP
rs1480494432	745	dbSNP
rs1052648176	752	dbSNP
rs1270505960	752	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.