miRTarBase - #MIRT472704


—
pre-miRNA Information
pre-miRNA hsa-mir-4433a   
Genomic Coordinates chr2: 64340759 - 64340839
Description Homo sapiens miR-4433a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4433a-3p
Sequence 51| ACAGGAGUGGGGGUGGGACAU |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs751480515 9 dbSNP
rs557760377 15 dbSNP
rs1479580865 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MYBL1   
Synonyms A-MYB, AMYB
Description MYB proto-oncogene like 1
Transcript NM_001080416   
Other Transcripts NM_001144755   
Expression
Putative miRNA Targets on MYBL1
3'UTR of MYBL1
(miRNA target sites are highlighted)		 
>MYBL1|NM_001080416|3'UTR
   1 TTGTTATTAAAATTGATGAAATGCCCCACTCCCTTACTGCAGTCTCTACTAAATTAGGTTGCAGTGAAATTTTTCTCAAT
  81 TAGTTGTTTTTAAAGTTGTAAGATAGCCCTTTTAATACAGCATCTTTTTTCTATTCTATATAGTAGGCAGAAAGCTAGTA
 161 AGTCACTTAAGGGGTAGATAGTTTCATAGTTTATTTTTTAAGAGATGAGATTTTTAAAAATTGTTTTTAAAGAACAAGAT
 241 GGGAAAATAATAGAATGTTCATGGATTTCTAAAAGTAAATTCTCATATATTTTCTTCACAAGATATATGTTGCTACTCTC
 321 TTGATGCTGCAGTTTTGTTATAGATAGGTGTATGAGTATATATGATTTCTGAAATTAGTCTATGTATGGAAAGCACACAT
 401 GATTTTATGAAGTACTTTTGCCCATGTGCTGATTTACTTAGGCTACCATTTACAAAGAAACACATTGAAAAGGAATTTAA
 481 AGGAAGGATAGAAAGTTGCACTACTAATTTTTTGTTTTTTTTTTCAGAAGCAGTAAAATTAACTACAGTGTTAAATGTAT
 561 TTATTTGAGCATAGTACTGAAAACAAAAAGCATTCAAAAAAGAGTTTTTTCTTTATTAGTAAATAGTATTTTCTTAATCT
 641 CAGAGGAGCTGAGAGTTTTGTTGAATGTATTGTACAGTATGTAGGAGCAGGAGAACTTTGTAAATTGGAAAGAAGTCTGT
 721 TTTTATAATTTATTTTTATTTTTAAAGCTTAAATGTAGATATTTATACGTATACAGGGTGCCTAGAAGCCAATGTTGTTT
 801 CCTGTTATTACAGCTAACACAGTAAAGAATAATTTTGACTTTAAGTATGAAACAGTAGTAAGTTATAGCTGCAAAGAATA
 881 CAATATCTATACTGTATGTCACATCTACCTAAATGTTGCACTATGCCCTTTAAATCATGCTGGTTATAAAGTAGTTCTAA
 961 AAATGTACTAAATAATAATTTAATATTTTCTTTTTAAATTATATCGGGGGTGGTCATATACATTAATCTGGTGATTTGTA
1041 TATGTGTTTGAAATTTTTGCATTTTGTTTAAAAAATAATATGGTACCTTGGTCCCTAAAAACAGTCTGCACTTAGAAGTT
1121 TATATTTACTCAGTGTTTCAGAAGTGGAGAACATTATCTTTTATTTATAAAAATATTTTGTCCTTTTTTAAATGTTTTGT
1201 GTTTCTCTACAGGTTACAACAGTTGCTTCAGTTGCCTGTTTTAGGTGTTTGCACTTATTTTATTTCTTCTTGAAAGAATT
1281 TTTATTTGCTTTTGTGGTAGAGATTATATGTAATTTTTTTTCAGTCATATAATGGTGTGCTGTCAACTTAAACACTGACA
1361 GGTAAATAGAATTGTACACTGTAGTTTGAATTATTTATAATTGACACACTCTCTCCCTCTCCACTCCTGAAGTATGCTGC
1441 TATAGAAAATAGCAGAATCGGCTTGCTGCTACGAGAGAAGGAAAGAGCGACCACCACTTGCACTGTGTGAAAAGATAAAA
1521 AACAAATGATGGCAAGTTCTCAAGTTAACTAAATGGAATCAACCATTACCAGGCAAATTCTTGCAAATACCAAAATACTA
1601 CTATGCCTTATAAAACAAAATGAAAGCAGGTTAAGATTTTCTGCTCTGTTTGTATGTTAATAGAAATGGAAATACTAAGT
1681 ATTTTAATGCTTAGCTCTTGAACAGTAGACCTAAAAGGGTTTTAAGCTATTTAAATCTACTTGCTAGTTTTTGCATATTT
1761 TATATATATATATATTTATATATATATATAGTGAGAAGTGAAGAAAATGTATGGTACTAAGATTATGCCTTATTGATAAA
1841 TAGATAAACCAATTTGAATCCTCTTAGCATGTTTAAGTATGTTGATTGCTTTCTAATTAATGAACTTCTCACAGAAATTT
1921 CACTTAGTGAAACCAATGATTGTAGCAAACTCATACTGGATCATTTCAGTTACCTTGAACTAATAGCACATAATGGTTTT
2001 TTGTTGTTGTTGTTTTTAATGTAGCCCTTACCTGGATATACATAGTCTGCAATCACCAAAGTATAATATCTTGTAAGGCT
2081 ATATTTTTTAAAGCATATTTTTTCTTGAGCATTAAATTATCCTAAATGGTAATATATTGTGGATAAGTCTGGGCTTATTG
2161 GACATAATACATATTTGGGTTGGTACTGGTTGAATCCTTCAGTTAACTGCTTTGTTGCTTTTTGCAAGATTTTTTATCTT
2241 AAACATGTCAGGCATCTTAAGTCACCTTTATACTGTTTTGTTCCTCTGAGTTTCTTTCAGTATGTTATACAAATGCCAGA
2321 CATAACATGTAGCAGCCATACTTGCATGGAAACTGACTACACATACATAATACTGCATTTTATTGTAAGGTTTTCACATT
2401 AATACAGCAATTACCCTGACTAAATTGAGTTTTGTGATATATGGAAAACTTCATTGTAAGAGAATCTTGCATACAATGTT
2481 GACATATTAACATCCAAAATAAAGCATCTGTGTACAAGCTGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uacAGGGUGGGGGUGAGGACa 5'
             |||| :|:||||||||| 
Target 5' ctcTCCC-TCTCCACTCCTGa 3'
 1411 - 1430 169.00 -27.10
2 
miRNA  3' uacagggugGGGGUGAGGaca 5'
                   |||||||||   
Target 5' gatgaaatgCCCCACTCCctt 3'
 15 - 35 120.00 -18.93
3 
miRNA  3' uacAGGGUGGGGGUGAGGACa 5'
             | |||  |  |:||:|| 
Target 5' catTACCAGGCAAATTCTTGc 3'
 1564 - 1584 118.00 -11.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31503172 28 COSMIC
COSN21244815 34 COSMIC
COSN20076318 48 COSMIC
COSN8519240 49 COSMIC
COSN30168681 56 COSMIC
COSN2285628 65 COSMIC
COSN30112207 74 COSMIC
COSN31493996 95 COSMIC
COSN31558114 179 COSMIC
COSN23300113 275 COSMIC
COSN28688958 295 COSMIC
COSN8096776 386 COSMIC
COSN29012657 514 COSMIC
COSN7675873 515 COSMIC
COSN21119684 621 COSMIC
COSN27359291 759 COSMIC
COSN31521273 768 COSMIC
COSN26646901 770 COSMIC
COSN8096775 1013 COSMIC
COSN31485517 1170 COSMIC
COSN31579454 1275 COSMIC
COSN8578110 1303 COSMIC
COSN31594758 1313 COSMIC
COSN31536491 1453 COSMIC
COSN31520727 1472 COSMIC
COSN31531868 1473 COSMIC
COSN9666333 1481 COSMIC
COSN17181742 1541 COSMIC
COSN31512770 1572 COSMIC
COSN17181741 1606 COSMIC
COSN28767030 1631 COSMIC
COSN31515518 1737 COSMIC
COSN23235258 1777 COSMIC
COSN17181743 1863 COSMIC
COSN31516239 1938 COSMIC
COSN17725487 2003 COSMIC
COSN17181740 2070 COSMIC
COSN31546684 2163 COSMIC
COSN23385505 2248 COSMIC
COSN26551524 2345 COSMIC
COSN16756581 2370 COSMIC
COSN31548717 2466 COSMIC
COSN26649709 2483 COSMIC
COSN8519239 2516 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751896536 1 dbSNP
rs766672793 3 dbSNP
rs892826375 4 dbSNP
rs367785536 25 dbSNP
rs1406732040 26 dbSNP
rs1413907886 27 dbSNP
rs374716760 28 dbSNP
rs1444599973 29 dbSNP
rs1346013100 30 dbSNP
rs1268624505 32 dbSNP
rs765360615 44 dbSNP
rs1321887381 46 dbSNP
rs1034216279 53 dbSNP
rs1012408421 57 dbSNP
rs1281773240 58 dbSNP
rs1352067876 63 dbSNP
rs1240060293 65 dbSNP
rs1001420053 68 dbSNP
rs1477862711 79 dbSNP
rs1362066593 101 dbSNP
rs1207674444 102 dbSNP
rs1261949600 115 dbSNP
rs1266280890 117 dbSNP
rs1055487722 120 dbSNP
rs1183430836 124 dbSNP
rs907012259 127 dbSNP
rs941087182 132 dbSNP
rs1164156553 133 dbSNP
rs574703266 136 dbSNP
rs749427324 138 dbSNP
rs1456232758 140 dbSNP
rs1390357855 143 dbSNP
rs1392200291 158 dbSNP
rs1256998624 166 dbSNP
rs1046675578 170 dbSNP
rs1210006626 172 dbSNP
rs533060729 186 dbSNP
rs570322566 194 dbSNP
rs1219266414 203 dbSNP
rs1339578371 206 dbSNP
rs1197213731 210 dbSNP
rs929925213 215 dbSNP
rs1456968183 218 dbSNP
rs1184094765 229 dbSNP
rs1340012509 234 dbSNP
rs1244961769 239 dbSNP
rs922539199 241 dbSNP
rs1186502619 250 dbSNP
rs977017971 253 dbSNP
rs550564485 257 dbSNP
rs1398046586 258 dbSNP
rs1220206385 262 dbSNP
rs1173125266 264 dbSNP
rs867911759 265 dbSNP
rs989575268 275 dbSNP
rs1047218477 282 dbSNP
rs1382039034 283 dbSNP
rs931285683 284 dbSNP
rs1303161192 285 dbSNP
rs1220062396 287 dbSNP
rs1031009425 288 dbSNP
rs1465382701 291 dbSNP
rs978084283 293 dbSNP
rs1403727246 297 dbSNP
rs1172752420 305 dbSNP
rs1264471002 306 dbSNP
rs919955119 317 dbSNP
rs1482194468 318 dbSNP
rs1199836967 319 dbSNP
rs1465682095 320 dbSNP
rs1318936265 324 dbSNP
rs1422378991 327 dbSNP
rs1430138521 328 dbSNP
rs1196079272 337 dbSNP
rs975635575 358 dbSNP
rs1177170747 359 dbSNP
rs1425240865 364 dbSNP
rs942966038 369 dbSNP
rs1464940201 374 dbSNP
rs971420452 378 dbSNP
rs1386088569 382 dbSNP
rs866007187 388 dbSNP
rs912694793 396 dbSNP
rs1339378233 397 dbSNP
rs1181599214 404 dbSNP
rs1302717631 411 dbSNP
rs1309961362 418 dbSNP
rs987364193 422 dbSNP
rs1260536699 423 dbSNP
rs1261286204 431 dbSNP
rs1012890155 448 dbSNP
rs1214255752 472 dbSNP
rs967608758 487 dbSNP
rs1488048336 491 dbSNP
rs895331533 504 dbSNP
rs1427327563 516 dbSNP
rs1431551384 523 dbSNP
rs1019972632 524 dbSNP
rs1175969459 525 dbSNP
rs1422071771 525 dbSNP
rs199738311 525 dbSNP
rs1005263491 526 dbSNP
rs1360319605 546 dbSNP
rs531895194 554 dbSNP
rs563222820 555 dbSNP
rs888196288 563 dbSNP
rs1364840034 567 dbSNP
rs1385801760 569 dbSNP
rs1199899125 574 dbSNP
rs1317339255 575 dbSNP
rs1256290389 577 dbSNP
rs1247109605 578 dbSNP
rs1341251391 579 dbSNP
rs1312279010 584 dbSNP
rs1237875884 598 dbSNP
rs1284982782 602 dbSNP
rs1222543284 604 dbSNP
rs1359947827 604 dbSNP
rs1046752169 605 dbSNP
rs770698072 605 dbSNP
rs957006420 608 dbSNP
rs549162852 624 dbSNP
rs1190625117 625 dbSNP
rs1033993952 627 dbSNP
rs1442041043 641 dbSNP
rs1466115919 643 dbSNP
rs76043847 649 dbSNP
rs1165605580 652 dbSNP
rs1166470045 653 dbSNP
rs1425734948 653 dbSNP
rs1347819613 672 dbSNP
rs1435327125 675 dbSNP
rs1459022222 677 dbSNP
rs1368617544 680 dbSNP
rs1378515429 681 dbSNP
rs1444449866 684 dbSNP
rs1163705772 686 dbSNP
rs1308496921 691 dbSNP
rs1383250048 693 dbSNP
rs942582056 695 dbSNP
rs911064610 696 dbSNP
rs1320071651 708 dbSNP
rs971728171 711 dbSNP
rs1221145221 712 dbSNP
rs1258735304 727 dbSNP
rs1459186559 730 dbSNP
rs1177285363 733 dbSNP
rs1238177295 747 dbSNP
rs1024260415 750 dbSNP
rs989272604 757 dbSNP
rs1183906028 759 dbSNP
rs1005122341 760 dbSNP
rs781766494 768 dbSNP
rs867777872 769 dbSNP
rs970772834 776 dbSNP
rs1179787413 778 dbSNP
rs1463665523 789 dbSNP
rs995606110 792 dbSNP
rs1249070200 796 dbSNP
rs991095472 798 dbSNP
rs372960521 800 dbSNP
rs1357155339 801 dbSNP
rs959578333 807 dbSNP
rs1265074073 811 dbSNP
rs898478804 812 dbSNP
rs1039732359 827 dbSNP
rs1356973055 831 dbSNP
rs1311250381 841 dbSNP
rs942747985 844 dbSNP
rs1376009624 845 dbSNP
rs181983434 847 dbSNP
rs369301495 861 dbSNP
rs1390910434 869 dbSNP
rs1025327480 876 dbSNP
rs76077785 882 dbSNP
rs189376264 889 dbSNP
rs1236039054 891 dbSNP
rs1422415852 892 dbSNP
rs989834425 895 dbSNP
rs1193926942 896 dbSNP
rs900848276 902 dbSNP
rs1476642436 909 dbSNP
rs1266305877 910 dbSNP
rs1169256426 913 dbSNP
rs1402332860 920 dbSNP
rs957121260 932 dbSNP
rs1416046346 942 dbSNP
rs1332166260 945 dbSNP
rs926927133 955 dbSNP
rs1431296133 964 dbSNP
rs1381801985 965 dbSNP
rs980168782 966 dbSNP
rs1439472495 969 dbSNP
rs1277600852 970 dbSNP
rs971127199 978 dbSNP
rs1362504114 985 dbSNP
rs1201716055 988 dbSNP
rs1221404859 990 dbSNP
rs1452253690 994 dbSNP
rs1277201510 995 dbSNP
rs1024625628 998 dbSNP
rs747507175 1005 dbSNP
rs1041073332 1011 dbSNP
rs1265796050 1014 dbSNP
rs1487079579 1018 dbSNP
rs1006809733 1019 dbSNP
rs950504089 1032 dbSNP
rs1489367563 1038 dbSNP
rs1287050710 1040 dbSNP
rs889704109 1059 dbSNP
rs1420248646 1079 dbSNP
rs143363878 1081 dbSNP
rs1358426192 1104 dbSNP
rs1398330808 1115 dbSNP
rs995554084 1140 dbSNP
rs1297874523 1153 dbSNP
rs898571706 1153 dbSNP
rs936475915 1163 dbSNP
rs923746275 1167 dbSNP
rs1241542499 1189 dbSNP
rs1042490416 1198 dbSNP
rs1039827576 1199 dbSNP
rs917928267 1205 dbSNP
rs991227066 1207 dbSNP
rs780348890 1209 dbSNP
rs758475071 1211 dbSNP
rs1235375321 1225 dbSNP
rs1245633568 1229 dbSNP
rs1440195865 1233 dbSNP
rs1160408785 1235 dbSNP
rs746911031 1245 dbSNP
rs959651450 1247 dbSNP
rs1418939814 1252 dbSNP
rs1158197805 1255 dbSNP
rs1391648812 1258 dbSNP
rs1331158082 1266 dbSNP
rs1051755018 1269 dbSNP
rs575448177 1272 dbSNP
rs1402590131 1274 dbSNP
rs1370366478 1280 dbSNP
rs913362942 1300 dbSNP
rs575936174 1301 dbSNP
rs1298442877 1303 dbSNP
rs936208210 1304 dbSNP
rs927043531 1306 dbSNP
rs1375146280 1307 dbSNP
rs555873703 1311 dbSNP
rs1266420596 1314 dbSNP
rs950900676 1322 dbSNP
rs1207735392 1323 dbSNP
rs1457863822 1326 dbSNP
rs1026868198 1327 dbSNP
rs539471212 1330 dbSNP
rs1439019513 1342 dbSNP
rs1478674004 1346 dbSNP
rs1187911397 1348 dbSNP
rs965460434 1353 dbSNP
rs1019315156 1369 dbSNP
rs1161724716 1387 dbSNP
rs1006552110 1388 dbSNP
rs777442165 1397 dbSNP
rs1377583764 1401 dbSNP
rs757033622 1412 dbSNP
rs889735487 1421 dbSNP
rs1478846468 1423 dbSNP
rs1053684609 1424 dbSNP
rs916936744 1442 dbSNP
rs149207980 1443 dbSNP
rs1000755844 1454 dbSNP
rs758143885 1459 dbSNP
rs983752105 1460 dbSNP
rs1042576149 1471 dbSNP
rs950618139 1472 dbSNP
rs917989310 1475 dbSNP
rs573025203 1488 dbSNP
rs553224156 1489 dbSNP
rs1257979319 1499 dbSNP
rs866854247 1505 dbSNP
rs539504557 1538 dbSNP
rs1440524047 1551 dbSNP
rs570559933 1552 dbSNP
rs1185682561 1562 dbSNP
rs1398693195 1563 dbSNP
rs973228185 1565 dbSNP
rs372035031 1573 dbSNP
rs145410594 1600 dbSNP
rs1421622378 1605 dbSNP
rs747890218 1606 dbSNP
rs1018769483 1607 dbSNP
rs1461878791 1616 dbSNP
rs753562338 1617 dbSNP
rs73261704 1631 dbSNP
rs1404764833 1646 dbSNP
rs1221088963 1650 dbSNP
rs1394724170 1654 dbSNP
rs909191129 1657 dbSNP
rs114829583 1661 dbSNP
rs761378845 1674 dbSNP
rs1010415758 1675 dbSNP
rs1306461156 1676 dbSNP
rs1233839080 1677 dbSNP
rs1257754599 1694 dbSNP
rs1482144160 1703 dbSNP
rs1429643210 1710 dbSNP
rs950932822 1716 dbSNP
rs919434620 1717 dbSNP
rs1196151466 1741 dbSNP
rs1415438503 1743 dbSNP
rs892033736 1748 dbSNP
rs1428037353 1758 dbSNP
rs549224354 1760 dbSNP
rs976653450 1764 dbSNP
rs1464986857 1765 dbSNP
rs1173360560 1768 dbSNP
rs1054658559 1774 dbSNP
rs529565203 1775 dbSNP
rs1296001692 1776 dbSNP
rs796410626 1776 dbSNP
rs965191626 1776 dbSNP
rs796065569 1778 dbSNP
rs1360653176 1784 dbSNP
rs906064017 1788 dbSNP
rs1019768844 1789 dbSNP
rs985148381 1790 dbSNP
rs1000788530 1791 dbSNP
rs1466456277 1791 dbSNP
rs953706011 1791 dbSNP
rs902427122 1811 dbSNP
rs1044502783 1812 dbSNP
rs1467238448 1814 dbSNP
rs11786211 1817 dbSNP
rs1259257144 1825 dbSNP
rs949830914 1832 dbSNP
rs1424471325 1841 dbSNP
rs200492226 1843 dbSNP
rs916875435 1856 dbSNP
rs983149206 1859 dbSNP
rs1193612966 1860 dbSNP
rs754605263 1861 dbSNP
rs1381273086 1868 dbSNP
rs928981820 1871 dbSNP
rs560279354 1874 dbSNP
rs546826947 1875 dbSNP
rs1239460953 1877 dbSNP
rs1189277414 1879 dbSNP
rs920510250 1880 dbSNP
rs973354099 1887 dbSNP
rs1344177020 1896 dbSNP
rs1458103438 1903 dbSNP
rs1442799584 1910 dbSNP
rs143975532 1913 dbSNP
rs1055639551 1914 dbSNP
rs1309938674 1922 dbSNP
rs760661689 1929 dbSNP
rs1378832527 1932 dbSNP
rs1237765450 1933 dbSNP
rs1283298530 1934 dbSNP
rs1316513970 1947 dbSNP
rs1222616084 1953 dbSNP
rs1267278190 1955 dbSNP
rs112630407 1956 dbSNP
rs1258201201 1957 dbSNP
rs1213606886 1963 dbSNP
rs1239377169 1973 dbSNP
rs1213506113 1975 dbSNP
rs775398307 1981 dbSNP
rs1177092811 1989 dbSNP
rs1407761045 1990 dbSNP
rs887785132 1994 dbSNP
rs985926082 1997 dbSNP
rs532447665 2003 dbSNP
rs1331942633 2015 dbSNP
rs929597890 2015 dbSNP
rs184183692 2024 dbSNP
rs575556738 2025 dbSNP
rs1444510610 2026 dbSNP
rs1278684835 2027 dbSNP
rs1379683492 2033 dbSNP
rs1382581007 2033 dbSNP
rs1229073462 2038 dbSNP
rs1315180767 2042 dbSNP
rs1332747447 2045 dbSNP
rs1232686345 2050 dbSNP
rs1258796128 2052 dbSNP
rs1459453900 2056 dbSNP
rs1203066411 2061 dbSNP
rs372208236 2073 dbSNP
rs1232645994 2075 dbSNP
rs1483808785 2081 dbSNP
rs1010173786 2084 dbSNP
rs1335314067 2104 dbSNP
rs553911660 2107 dbSNP
rs944851440 2126 dbSNP
rs140244577 2129 dbSNP
rs1328146627 2130 dbSNP
rs1169777222 2132 dbSNP
rs1359517743 2137 dbSNP
rs1000410876 2145 dbSNP
rs905985072 2158 dbSNP
rs1044585710 2163 dbSNP
rs949808338 2164 dbSNP
rs1416151802 2171 dbSNP
rs533926485 2173 dbSNP
rs1472999809 2177 dbSNP
rs895550611 2189 dbSNP
rs1242340450 2200 dbSNP
rs1047553086 2201 dbSNP
rs928950531 2209 dbSNP
rs953737999 2212 dbSNP
rs920267421 2213 dbSNP
rs1032051401 2215 dbSNP
rs979085990 2217 dbSNP
rs1313136283 2222 dbSNP
rs973279169 2228 dbSNP
rs1458999625 2236 dbSNP
rs1238752978 2237 dbSNP
rs562063406 2244 dbSNP
rs910349595 2252 dbSNP
rs1021275411 2253 dbSNP
rs1396850231 2255 dbSNP
rs1167242202 2269 dbSNP
rs1203130951 2271 dbSNP
rs542113868 2274 dbSNP
rs987309201 2280 dbSNP
rs568158254 2288 dbSNP
rs1305273152 2290 dbSNP
rs192716760 2291 dbSNP
rs1228600474 2295 dbSNP
rs1359133945 2297 dbSNP
rs1313308545 2298 dbSNP
rs1242807603 2302 dbSNP
rs1414378307 2303 dbSNP
rs1299077731 2333 dbSNP
rs1428791189 2367 dbSNP
rs1033437525 2372 dbSNP
rs954726176 2377 dbSNP
rs573187876 2384 dbSNP
rs1221466753 2397 dbSNP
rs922707093 2398 dbSNP
rs1347662107 2399 dbSNP
rs1378211755 2400 dbSNP
rs1287783797 2405 dbSNP
rs887858817 2414 dbSNP
rs1444933504 2441 dbSNP
rs1049083338 2447 dbSNP
rs1246812801 2453 dbSNP
rs929284753 2459 dbSNP
rs1191725273 2462 dbSNP
rs1440091855 2466 dbSNP
rs988889292 2470 dbSNP
rs767050799 2474 dbSNP
rs1032976062 2476 dbSNP
rs944943028 2490 dbSNP
rs1387341808 2492 dbSNP
rs368516029 2499 dbSNP
rs1399180045 2503 dbSNP
rs1317681771 2504 dbSNP
rs1331801153 2504 dbSNP
rs189404028 2505 dbSNP
rs1301968768 2522 dbSNP
rs773911365 2523 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uacAGGGUGGGGGUGAGGACa 5'
             |||| :|:||||||||| 
Target 5' cucUCCC-UCUCCACUCCUG- 3'
 		8 - 26
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uacAGGGUGGGGGUGAGGACa 5'
             |||| :|:||||||||| 
Target 5' cucUCCC-UCUCCACUCCUG- 3'
 		6 - 24
Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000522677.3 | 3UTR | ACACACUCUCUCCCUCUCCACUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
256 hsa-miR-4433a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088097 SEPT2 septin 2 2 2
MIRT143134 MGRN1 mahogunin ring finger 1 2 2
MIRT153912 NCOA3 nuclear receptor coactivator 3 2 2
MIRT154894 GNAS GNAS complex locus 2 4
MIRT200996 ZNF805 zinc finger protein 805 2 2
MIRT215729 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT235593 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT263250 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT317951 CDC5L cell division cycle 5 like 2 4
MIRT325572 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT354739 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT444552 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 4
MIRT446978 SUSD5 sushi domain containing 5 2 2
MIRT451036 ZNF610 zinc finger protein 610 2 2
MIRT451596 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT452025 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452594 CA6 carbonic anhydrase 6 2 2
MIRT452768 TCEA3 transcription elongation factor A3 2 4
MIRT452959 ZNF844 zinc finger protein 844 2 2
MIRT453191 ACSF2 acyl-CoA synthetase family member 2 2 2
MIRT453382 RHD Rh blood group D antigen 2 2
MIRT453685 CEBPD CCAAT/enhancer binding protein delta 2 2
MIRT455272 DDX39B DExD-box helicase 39B 2 8
MIRT455346 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT456494 SERAC1 serine active site containing 1 2 2
MIRT456585 NID1 nidogen 1 2 2
MIRT456888 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457123 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT457852 ZNF324B zinc finger protein 324B 2 2
MIRT457987 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT459278 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT459625 SLC25A33 solute carrier family 25 member 33 2 2
MIRT459715 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT460057 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460182 UNK unkempt family zinc finger 2 6
MIRT460288 PDE11A phosphodiesterase 11A 2 2
MIRT460841 EGF epidermal growth factor 2 4
MIRT460860 TBC1D19 TBC1 domain family member 19 2 2
MIRT461519 EMC7 ER membrane protein complex subunit 7 2 2
MIRT461729 SLC27A1 solute carrier family 27 member 1 2 4
MIRT461821 SNAP23 synaptosome associated protein 23 2 2
MIRT462066 CCDC77 coiled-coil domain containing 77 2 4
MIRT462084 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT462508 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 10
MIRT464239 VCP valosin containing protein 2 2
MIRT465316 TRAF5 TNF receptor associated factor 5 2 2
MIRT466549 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467128 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT468091 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT469630 RAD21 RAD21 cohesin complex component 2 6
MIRT471097 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472704 MYBL1 MYB proto-oncogene like 1 2 2
MIRT472830 MTMR10 myotubularin related protein 10 2 2
MIRT472872 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT472895 MTDH metadherin 2 2
MIRT473728 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT473859 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474047 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT474297 LAMC1 laminin subunit gamma 1 2 2
MIRT474658 KLF13 Kruppel like factor 13 2 2
MIRT475234 IKZF3 IKAROS family zinc finger 3 2 2
MIRT475500 HSP90B1 heat shock protein 90 beta family member 1 2 2
MIRT475742 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT475793 HDGF heparin binding growth factor 2 2
MIRT477254 ERGIC2 ERGIC and golgi 2 2 2
MIRT478228 DDX52 DExD-box helicase 52 2 2
MIRT478393 DCTN5 dynactin subunit 5 2 2
MIRT478754 CS citrate synthase 2 2
MIRT478827 CRKL CRK like proto-oncogene, adaptor protein 2 4
MIRT480234 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480597 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT484121 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT484689 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486331 C11orf54 chromosome 11 open reading frame 54 2 4
MIRT488599 FAM3C family with sequence similarity 3 member C 2 8
MIRT488833 MRRF mitochondrial ribosome recycling factor 2 2
MIRT492523 RAB15 RAB15, member RAS oncogene family 2 4
MIRT493632 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT500026 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501075 SMAD7 SMAD family member 7 2 8
MIRT503094 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503336 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT505465 STMN1 stathmin 1 2 4
MIRT505726 SERTAD3 SERTA domain containing 3 2 4
MIRT509333 MS4A4A membrane spanning 4-domains A4A 2 2
MIRT509978 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 4
MIRT513068 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT513446 EMP1 epithelial membrane protein 1 2 6
MIRT513736 PSD3 pleckstrin and Sec7 domain containing 3 2 4
MIRT513996 CENPQ centromere protein Q 2 4
MIRT516538 MIXL1 Mix paired-like homeobox 2 2
MIRT517606 SAV1 salvador family WW domain containing protein 1 2 2
MIRT518064 CEP89 centrosomal protein 89 2 2
MIRT518119 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT518325 WDR92 WD repeat domain 92 2 2
MIRT519048 ABCB11 ATP binding cassette subfamily B member 11 2 2
MIRT520972 SPPL2A signal peptide peptidase like 2A 2 4
MIRT521359 RPL35A ribosomal protein L35a 2 2
MIRT523359 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT523801 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT524622 C7orf73 short transmembrane mitochondrial protein 1 2 2
MIRT525550 PHB2 prohibitin 2 2 4
MIRT529709 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT531605 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT532387 UMPS uridine monophosphate synthetase 2 2
MIRT534468 SCD stearoyl-CoA desaturase 2 4
MIRT537546 ETNK1 ethanolamine kinase 1 2 2
MIRT541619 C11orf31 selenoprotein H 2 2
MIRT548380 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549523 HDDC2 HD domain containing 2 2 2
MIRT549774 SOD2 superoxide dismutase 2 2 2
MIRT550578 SLC2A5 solute carrier family 2 member 5 2 2
MIRT551498 CENPN centromere protein N 2 4
MIRT552301 ITGA3 integrin subunit alpha 3 2 2
MIRT555400 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT556399 LUC7L LUC7 like 2 2
MIRT557047 HOXB3 homeobox B3 2 2
MIRT558072 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 2
MIRT559659 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT561239 ZNF354B zinc finger protein 354B 2 2
MIRT566899 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT568786 FAM120B family with sequence similarity 120B 2 2
MIRT574014 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT574885 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 2
MIRT575243 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576194 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576309 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576484 Lhx4 LIM homeobox protein 4 2 3
MIRT576646 Mill2 MHC I like leukocyte 2 1 1
MIRT576708 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576855 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576950 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT617133 ZNF556 zinc finger protein 556 2 4
MIRT617928 ZNF783 zinc finger family member 783 2 2
MIRT618981 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT621100 SIX3 SIX homeobox 3 2 2
MIRT624537 BROX BRO1 domain and CAAX motif containing 2 2
MIRT625663 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT627059 DCTN6 dynactin subunit 6 2 2
MIRT628319 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT630859 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT632295 TMEM65 transmembrane protein 65 2 2
MIRT634115 ZNF207 zinc finger protein 207 2 2
MIRT634736 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT635655 NDST3 N-deacetylase and N-sulfotransferase 3 2 2
MIRT635772 PDCL3 phosducin like 3 2 2
MIRT635911 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT636365 OGFRL1 opioid growth factor receptor like 1 2 4
MIRT637251 GLRX2 glutaredoxin 2 2 2
MIRT638705 FZD4 frizzled class receptor 4 2 2
MIRT639640 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT639676 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT642267 SMIM17 small integral membrane protein 17 2 2
MIRT642372 ZNF581 zinc finger protein 581 2 2
MIRT643545 SLC25A17 solute carrier family 25 member 17 2 2
MIRT647994 PDE12 phosphodiesterase 12 2 2
MIRT649094 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT650993 ZNF770 zinc finger protein 770 2 2
MIRT651956 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT652977 SUN2 Sad1 and UNC84 domain containing 2 2 2
MIRT654389 RBM12B RNA binding motif protein 12B 2 2
MIRT655637 OLFML2A olfactomedin like 2A 2 2
MIRT655729 NRXN3 neurexin 3 2 2
MIRT658171 FCHSD1 FCH and double SH3 domains 1 2 2
MIRT660937 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662112 CERKL ceramide kinase like 2 2
MIRT662302 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT662993 TMEM59 transmembrane protein 59 2 2
MIRT663071 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663704 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663864 MUC20 mucin 20, cell surface associated 2 2
MIRT665185 HAUS5 HAUS augmin like complex subunit 5 2 4
MIRT665402 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665688 TNPO3 transportin 3 2 2
MIRT665795 TMEM170A transmembrane protein 170A 2 2
MIRT665847 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT666999 PDPN podoplanin 2 2
MIRT667598 LIPC lipase C, hepatic type 2 2
MIRT668576 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT670960 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT671187 ZNF891 zinc finger protein 891 2 2
MIRT671739 ZNF451 zinc finger protein 451 2 2
MIRT672745 ZNF585B zinc finger protein 585B 2 4
MIRT673446 ZNF583 zinc finger protein 583 2 2
MIRT679843 GPR75 G protein-coupled receptor 75 2 2
MIRT680556 ZNF584 zinc finger protein 584 2 2
MIRT680661 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT681285 RFC2 replication factor C subunit 2 2 2
MIRT683264 ZNF329 zinc finger protein 329 2 2
MIRT684519 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT685065 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685157 DTWD2 DTW domain containing 2 2 2
MIRT685168 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685470 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT686001 NEK4 NIMA related kinase 4 2 2
MIRT687027 RNF24 ring finger protein 24 2 2
MIRT687543 MOB1B MOB kinase activator 1B 2 2
MIRT687592 MANEAL mannosidase endo-alpha like 2 2
MIRT687753 KIAA1328 KIAA1328 2 2
MIRT688050 GLUL glutamate-ammonia ligase 2 2
MIRT688374 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT688802 CBFA2T3 CBFA2/RUNX1 translocation partner 3 2 2
MIRT688957 ATXN3 ataxin 3 2 2
MIRT689281 C5AR2 complement component 5a receptor 2 2 2
MIRT689988 NNMT nicotinamide N-methyltransferase 2 2
MIRT689997 MMP17 matrix metallopeptidase 17 2 2
MIRT690014 LUZP2 leucine zipper protein 2 2 2
MIRT690161 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690379 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT690563 MICA MHC class I polypeptide-related sequence A 2 2
MIRT691891 EVC EvC ciliary complex subunit 1 2 2
MIRT693107 SCNM1 sodium channel modifier 1 2 2
MIRT693832 ZFP64 ZFP64 zinc finger protein 2 2
MIRT694105 ZNF446 zinc finger protein 446 2 2
MIRT694179 ZNF486 zinc finger protein 486 2 2
MIRT694475 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT694998 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695031 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695163 TCTN2 tectonic family member 2 2 2
MIRT695525 SLC25A34 solute carrier family 25 member 34 2 2
MIRT696067 ZNF264 zinc finger protein 264 2 2
MIRT696616 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT696661 AGXT2 alanine--glyoxylate aminotransferase 2 2 2
MIRT696705 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT697173 INMT indolethylamine N-methyltransferase 2 2
MIRT697303 ZNF652 zinc finger protein 652 2 2
MIRT697491 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT698657 TERF2 telomeric repeat binding factor 2 2 2
MIRT699042 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699185 SLX4IP SLX4 interacting protein 2 2
MIRT699598 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT700150 RNF115 ring finger protein 115 2 2
MIRT700720 PNO1 partner of NOB1 homolog 2 2
MIRT700870 PER2 period circadian clock 2 2 2
MIRT700912 PDXK pyridoxal kinase 2 2
MIRT701095 PAPOLG poly(A) polymerase gamma 2 2
MIRT701194 OTUD3 OTU deubiquitinase 3 2 2
MIRT702203 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT702272 LHX4 LIM homeobox 4 2 3
MIRT703125 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT703252 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT703262 GNL3L G protein nucleolar 3 like 2 2
MIRT703440 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704321 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704393 CTSS cathepsin S 2 2
MIRT704483 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT704880 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT704926 CCDC36 coiled-coil domain containing 36 2 2
MIRT705175 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT706561 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT707048 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT711497 PGD phosphogluconate dehydrogenase 2 2
MIRT716644 EPGN epithelial mitogen 2 2
MIRT720083 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT722288 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT725468 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4433a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4433a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4433a Vincristine 5978 approved resistant cell line (W1)
hsa-mir-4433a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4433a-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4433a-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission