miRTarBase - #MIRT472790


—
pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-5p
Sequence 14| CGUGUUCACAGCGGACCUUGAU |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 8 8 + 64379180 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1280076135 1 dbSNP
rs775858016 4 dbSNP
rs760972715 7 dbSNP
rs1334649236 11 dbSNP
rs1160219511 12 dbSNP
rs764591061 12 dbSNP
rs1261326747 13 dbSNP
rs1344491363 20 dbSNP
rs1340798465 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol MTMR4   
Synonyms FYVE-DSP2, ZFYVE11
Description myotubularin related protein 4
Transcript NM_004687   
Expression
Putative miRNA Targets on MTMR4
3'UTR of MTMR4
(miRNA target sites are highlighted)		 
>MTMR4|NM_004687|3'UTR
   1 ATGCCGGGGAGAAACCTGTCCAATTTTAGCAGGTTTGAAGGGAGGATCTTCTTCAGTTGTAGTTTGGAAGGTTCCTTGGT
  81 GTGGCTCATGAAATCACAGAGCTCAGAGATACCATCTTGAGAAATCCTCCTTGGTATCATGAAACTGGAGCAGAGGAATT
 161 GCAATTTAGCAGGAGGTCCTCTACTGGTGATACCCTCACCTTGGGGTAATGGTCCTAACCCAGACCCAGGGTCTGGAAGC
 241 TTAATGTTGAGTTGGTGACTCCAGCCTCTTTCTCCTGGAGGTCACAAGATGATGATTGCGTAGATGTTGCCTGGTGCAAA
 321 GTGCCCCAAACAGCAATAGAAAGGCATATGTATAACCAAACTCCAAGTGATAACCAGACCCATCTCTCCTCCACCTTGAC
 401 AAAAGCAGATTATAGTATACAAGGTAGGAATTCCTGTCCTATTTGAGATGAACTATATCCTGTACCTCTGTGCTCTGTGT
 481 CTGCATGAAGGCTCAGCCTTTAGAGGCACTCCTTCTAGTTGCATTAGTACTGTCTTTCTGTGGAGTTTGGTTTGAAGACT
 561 GGCTCAGCAAGTGGAGGTTTCAATGTATTTTTCAGTTGGCTCATCAGCCAGCATTGGTGAATATTCAGTTTAGGGGAACA
 641 GTTCTAGGGAGTGAGACATTTTTGGGAGCAGAGGAAAACTCTGCTGATGTTCGGTCCTGGCAAACATTGAGTTATTTTGA
 721 GCTGTGAAGGCAGTCGTCTCTGTTACACAGTGGCAGCTCTTGAGTTATGCACTGTGAAGAATGAGAAGGGAAAAGCAAAA
 801 ATTATCCTTGTGAAATATCTGCTGATTGTGCCCTACTCTTTGCACCTGACTTTTCCTAGTTGTCCTGGTGCTAACACAGG
 881 AGCTACACCTTGATCCTCTCCTGGCATGAAAATAAAACAAAGGTTTTCGTTGTTGTTGTTCCATTGCCCATTTCCCCCAT
 961 GTTGTCTTTCCCTTGGCTGATGCCTCCTCTGGGTCACATTGCTTCTTATCCTGAACACTTGACACCTTGAGGGTAGAATT
1041 TAGCGTTTGGTTTTTACCTCCTAGCATATGCTGTTTGGTATGTGAGGGTTTCAGTACAAATGCTGCTGTCTATTTCTGTG
1121 CACTTAACAATGGAACCCAAACAGAAGAGAATAAAGCCTTGATACCAAAATTGGGAAAGAACATGTGTCCATTTGGACCA
1201 AACGTTGTTGGTTTTTAAAAAATTTTATTTTGTTTTTTTGTTTTTGTTTTTGTTTTTTTTCATCTTAATATGTACCAGTG
1281 GCACTTAACCAAAAGATACAGTGATATAGCCATGTACTGTGGGTGGGACAGATACAGTCTCCTTGGCCTATAATGAAACC
1361 ACTAGGACTTTATACAGTTTTCCTTAATTTGTTGACATATAAATGGTAAATTATATTTAGGCTTATCCTGTTTTGAAATG
1441 ATGGTAGTCATCTTTCTTACTGCTACTTTCATGTTGCTTTCTAGAAAACAGCATTTCATTCCAAAATAACTAGGATCTGC
1521 ATTTAGAACAAGAATCATTATTTGTCCTGACCTTTTCAGTCCTACAGAGACGCATCTGTGGTTCTTTTGTACTTGCCATA
1601 GATGTAACCTAAAAAGTTTTGGCATATTTAGGTCAGCCTAGCGGAACTTTTTTTTTCATTTAAATGGAGCTGAATAATGG
1681 AGATTTTGTGTCTGCAAAATTCCTGAGATCATTGAAAAAGTAACAAGCTGTTCCTTGTTTCTGATACATAAAATTATTTT
1761 AAGCATTTTATCAATCATTAAAATTTACTGCCAGTTGTGAGTGGCTTTTTAATTAACTTGTCTTTCATTGCACTTCACTC
1841 TGCCTGTTTTCAAGGGGAGTAAGATTGGTAACATTTGGGGAGACTGTATCTGTCTACTTAGCGTGGCTGTTTTGAGGGAC
1921 TGTCCCATCAGTGAACAAACTGCATGGCCTTGGAGAGAGACTCTGGGCTCTTGGCTCAGATGTGTTCATCAAATACTCCT
2001 TTCAGAGCTGTTGTGGGTGTAAGTGACATGATGTGGCCAAAAATCCAAACTGTGCAGTTGCGTTGTGACAAACATGCAAT
2081 GTGCTGTAAAAATTCAATACAGTTTAAATAAAATCTCTATATTAGTGCTGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaGUUCCAG----GCGA-------CACUUGUGc 5'
            | :||||    :|||        ||||||| 
Target 5' ctCTGGGTCACATTGCTTCTTATCCTGAACACt 3'
 987 - 1019 142.00 -12.80
2 
miRNA  3' uaguucCAGG--CGACACUUGUgc 5'
                ||||   | |||||||  
Target 5' gggactGTCCCATCAGTGAACAaa 3'
 1916 - 1939 134.00 -11.50
3 
miRNA  3' uaguucCAGGCGACACUUGUGc 5'
                ||::| | |||| || 
Target 5' tgtggaGTTTGGTTTGAAGACt 3'
 539 - 560 124.00 -8.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31535562 2 COSMIC
COSN31488604 56 COSMIC
COSN1724242 136 COSMIC
COSN31578827 226 COSMIC
COSN26537470 400 COSMIC
COSN31544931 438 COSMIC
COSN9671573 688 COSMIC
COSN1199143 722 COSMIC
COSN21764835 753 COSMIC
COSN29450067 823 COSMIC
COSN26482352 900 COSMIC
COSN31552598 938 COSMIC
COSN19437116 1021 COSMIC
COSN31479623 1161 COSMIC
COSN31532228 1232 COSMIC
COSN29963399 1252 COSMIC
COSN24294764 1355 COSMIC
COSN28646891 1412 COSMIC
COSN6108008 1591 COSMIC
COSN31576033 1647 COSMIC
COSN31610910 1647 COSMIC
COSN30539230 1808 COSMIC
COSN26549035 1838 COSMIC
COSN31544208 1840 COSMIC
COSN31591559 1890 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1056396519 4 dbSNP
rs180972693 5 dbSNP
rs749793644 6 dbSNP
rs1297485509 14 dbSNP
rs778355584 15 dbSNP
rs1398179845 16 dbSNP
rs756700071 24 dbSNP
rs1466334582 29 dbSNP
rs1205877604 32 dbSNP
rs375200949 40 dbSNP
rs773627337 43 dbSNP
rs1425875658 44 dbSNP
rs1415193637 45 dbSNP
rs1270302147 59 dbSNP
rs981744616 62 dbSNP
rs1427224456 63 dbSNP
rs1362696800 64 dbSNP
rs140635960 71 dbSNP
rs1159872117 72 dbSNP
rs1173860012 79 dbSNP
rs1016886283 80 dbSNP
rs1303500115 81 dbSNP
rs760017812 88 dbSNP
rs950917953 91 dbSNP
rs1375658643 102 dbSNP
rs1326946963 111 dbSNP
rs1183765953 114 dbSNP
rs1419555125 115 dbSNP
rs576496584 121 dbSNP
rs865871584 127 dbSNP
rs529007495 131 dbSNP
rs774741419 140 dbSNP
rs1245757656 153 dbSNP
rs1482112751 154 dbSNP
rs896275958 156 dbSNP
rs1332698535 162 dbSNP
rs114469132 164 dbSNP
rs1249217542 165 dbSNP
rs1211797466 169 dbSNP
rs1347466116 175 dbSNP
rs189108812 178 dbSNP
rs1240932168 179 dbSNP
rs377474019 183 dbSNP
rs903524624 194 dbSNP
rs564803072 197 dbSNP
rs763328703 199 dbSNP
rs1306906194 201 dbSNP
rs1408596750 204 dbSNP
rs1460405036 207 dbSNP
rs1356748977 214 dbSNP
rs1312965971 223 dbSNP
rs1395885572 227 dbSNP
rs1392088885 230 dbSNP
rs975232487 252 dbSNP
rs1399645603 253 dbSNP
rs964066672 265 dbSNP
rs1316188960 266 dbSNP
rs772754480 269 dbSNP
rs769423318 282 dbSNP
rs540353028 299 dbSNP
rs1008143089 300 dbSNP
rs951380302 303 dbSNP
rs184937106 305 dbSNP
rs1363081714 317 dbSNP
rs554591070 322 dbSNP
rs1476155778 326 dbSNP
rs1200054837 329 dbSNP
rs3087762 344 dbSNP
rs995758966 346 dbSNP
rs1183746605 349 dbSNP
rs1441964764 357 dbSNP
rs780738085 358 dbSNP
rs1055944924 360 dbSNP
rs1322275985 364 dbSNP
rs575149521 374 dbSNP
rs1192170249 375 dbSNP
rs539852101 382 dbSNP
rs1463461893 391 dbSNP
rs1172989262 394 dbSNP
rs879116965 396 dbSNP
rs1403930570 408 dbSNP
rs1469488701 413 dbSNP
rs746910560 415 dbSNP
rs780099299 420 dbSNP
rs181166910 427 dbSNP
rs974808372 430 dbSNP
rs1327588226 438 dbSNP
rs758285874 450 dbSNP
rs909226503 462 dbSNP
rs796241886 466 dbSNP
rs781104937 468 dbSNP
rs762423453 470 dbSNP
rs951018777 485 dbSNP
rs1486388222 486 dbSNP
rs1262155506 493 dbSNP
rs949156902 508 dbSNP
rs913562151 511 dbSNP
rs538410556 514 dbSNP
rs767493652 517 dbSNP
rs1052560853 521 dbSNP
rs190246758 522 dbSNP
rs1177217507 538 dbSNP
rs1361185986 544 dbSNP
rs960872426 561 dbSNP
rs1033390450 565 dbSNP
rs1386043699 566 dbSNP
rs1402428577 571 dbSNP
rs1001973776 573 dbSNP
rs1345405737 577 dbSNP
rs866819796 582 dbSNP
rs1293318196 583 dbSNP
rs925202405 592 dbSNP
rs1314827646 595 dbSNP
rs975180100 598 dbSNP
rs1237811138 601 dbSNP
rs1021990898 605 dbSNP
rs184192578 614 dbSNP
rs1220194558 615 dbSNP
rs1009881486 617 dbSNP
rs912434887 633 dbSNP
rs1229655700 634 dbSNP
rs891374942 635 dbSNP
rs1158602559 650 dbSNP
rs986838883 663 dbSNP
rs1421953244 670 dbSNP
rs1301640259 673 dbSNP
rs1382493486 685 dbSNP
rs1365582496 692 dbSNP
rs144883664 693 dbSNP
rs567540207 694 dbSNP
rs995932472 699 dbSNP
rs1294789489 706 dbSNP
rs1318303368 711 dbSNP
rs1370458678 712 dbSNP
rs1462902738 719 dbSNP
rs1307206300 725 dbSNP
rs962964774 735 dbSNP
rs1034609310 736 dbSNP
rs756352974 740 dbSNP
rs1360088553 750 dbSNP
rs79308060 756 dbSNP
rs1248559354 759 dbSNP
rs909185432 768 dbSNP
rs530929835 770 dbSNP
rs1176666992 773 dbSNP
rs1239055659 778 dbSNP
rs1366849741 781 dbSNP
rs1195521053 783 dbSNP
rs1162132052 789 dbSNP
rs1447802017 797 dbSNP
rs1247756995 802 dbSNP
rs1013330216 807 dbSNP
rs1167483710 815 dbSNP
rs767557575 819 dbSNP
rs1440903509 831 dbSNP
rs1052077169 841 dbSNP
rs1274326106 843 dbSNP
rs1209836959 845 dbSNP
rs1449938199 856 dbSNP
rs1353631452 859 dbSNP
rs929539566 866 dbSNP
rs546457059 867 dbSNP
rs1229979650 868 dbSNP
rs1270852962 869 dbSNP
rs1306813029 869 dbSNP
rs1203992993 873 dbSNP
rs1258783743 876 dbSNP
rs1271445230 882 dbSNP
rs936339814 883 dbSNP
rs1242955113 886 dbSNP
rs925182597 889 dbSNP
rs1039594134 896 dbSNP
rs1473303171 899 dbSNP
rs1364034715 901 dbSNP
rs1183943184 903 dbSNP
rs942654501 929 dbSNP
rs1409892550 938 dbSNP
rs1170787144 941 dbSNP
rs1401758959 949 dbSNP
rs1295008975 964 dbSNP
rs1335611996 965 dbSNP
rs1359354876 971 dbSNP
rs563939524 977 dbSNP
rs912381071 986 dbSNP
rs573905249 993 dbSNP
rs1215033607 998 dbSNP
rs1278928046 1007 dbSNP
rs986619506 1014 dbSNP
rs951474010 1016 dbSNP
rs918681052 1025 dbSNP
rs974068204 1032 dbSNP
rs960841754 1045 dbSNP
rs1212767027 1051 dbSNP
rs552127621 1058 dbSNP
rs1475375773 1065 dbSNP
rs1194978465 1066 dbSNP
rs1425177871 1077 dbSNP
rs1388583227 1078 dbSNP
rs1175042916 1083 dbSNP
rs1033861580 1085 dbSNP
rs1415804672 1087 dbSNP
rs533547112 1088 dbSNP
rs1315980769 1097 dbSNP
rs1344318208 1103 dbSNP
rs980504706 1111 dbSNP
rs1400574861 1112 dbSNP
rs759576425 1112 dbSNP
rs980344513 1120 dbSNP
rs1343542001 1137 dbSNP
rs1221806612 1144 dbSNP
rs752087750 1161 dbSNP
rs192090807 1181 dbSNP
rs1274334139 1185 dbSNP
rs1346053214 1186 dbSNP
rs971669645 1203 dbSNP
rs1282631434 1204 dbSNP
rs967849019 1205 dbSNP
rs1022377405 1208 dbSNP
rs1024462731 1217 dbSNP
rs1490000531 1222 dbSNP
rs1389761572 1232 dbSNP
rs892135575 1232 dbSNP
rs1478810627 1238 dbSNP
rs1186957904 1240 dbSNP
rs539943409 1241 dbSNP
rs998068943 1244 dbSNP
rs1160203325 1249 dbSNP
rs1254085738 1250 dbSNP
rs1198708065 1252 dbSNP
rs1450400450 1257 dbSNP
rs539051675 1258 dbSNP
rs115198502 1260 dbSNP
rs1039542695 1261 dbSNP
rs943450779 1261 dbSNP
rs1241408565 1262 dbSNP
rs1353219270 1262 dbSNP
rs1288580013 1271 dbSNP
rs892178912 1275 dbSNP
rs887908389 1281 dbSNP
rs1267482338 1289 dbSNP
rs1272036755 1295 dbSNP
rs1031168446 1307 dbSNP
rs1179023261 1313 dbSNP
rs1231994111 1324 dbSNP
rs1000657806 1326 dbSNP
rs1180340800 1346 dbSNP
rs903521033 1350 dbSNP
rs1423966143 1351 dbSNP
rs1163719675 1356 dbSNP
rs1236115396 1361 dbSNP
rs1039373680 1362 dbSNP
rs1407192828 1371 dbSNP
rs1274030441 1375 dbSNP
rs1376509334 1380 dbSNP
rs1434156629 1394 dbSNP
rs929289120 1400 dbSNP
rs942602163 1402 dbSNP
rs560823718 1407 dbSNP
rs1329520177 1409 dbSNP
rs919264732 1410 dbSNP
rs189441787 1412 dbSNP
rs763232293 1419 dbSNP
rs200739874 1421 dbSNP
rs574907365 1429 dbSNP
rs1056706884 1438 dbSNP
rs1266600905 1445 dbSNP
rs1359045888 1456 dbSNP
rs1193642856 1458 dbSNP
rs891059077 1460 dbSNP
rs773623812 1461 dbSNP
rs1180053750 1471 dbSNP
rs1410577145 1488 dbSNP
rs939606410 1504 dbSNP
rs1166933311 1511 dbSNP
rs1370189505 1514 dbSNP
rs1436831933 1531 dbSNP
rs556808969 1534 dbSNP
rs1166240041 1537 dbSNP
rs778984551 1552 dbSNP
rs1396000824 1559 dbSNP
rs55695958 1565 dbSNP
rs1477271478 1566 dbSNP
rs918640276 1569 dbSNP
rs914954831 1571 dbSNP
rs577746907 1572 dbSNP
rs941491445 1585 dbSNP
rs1260910261 1590 dbSNP
rs1482721265 1593 dbSNP
rs1200878817 1596 dbSNP
rs956377587 1597 dbSNP
rs1445212332 1611 dbSNP
rs1192796970 1621 dbSNP
rs139042641 1630 dbSNP
rs1478219120 1642 dbSNP
rs980124097 1643 dbSNP
rs1172873387 1657 dbSNP
rs998047473 1657 dbSNP
rs971609035 1664 dbSNP
rs963965961 1665 dbSNP
rs1404718817 1668 dbSNP
rs1212488660 1671 dbSNP
rs1341645607 1677 dbSNP
rs1220009216 1704 dbSNP
rs1018061704 1708 dbSNP
rs1348187515 1712 dbSNP
rs1277590874 1720 dbSNP
rs1257571268 1727 dbSNP
rs1005345918 1730 dbSNP
rs35521907 1735 dbSNP
rs1024569177 1745 dbSNP
rs1217245328 1746 dbSNP
rs988953095 1753 dbSNP
rs1050751617 1755 dbSNP
rs1215602919 1764 dbSNP
rs956399443 1780 dbSNP
rs1263870503 1781 dbSNP
rs888285888 1782 dbSNP
rs1196011001 1785 dbSNP
rs1033215135 1788 dbSNP
rs1265287605 1814 dbSNP
rs1432826749 1817 dbSNP
rs1177010859 1819 dbSNP
rs1379565678 1826 dbSNP
rs534803645 1836 dbSNP
rs1452134995 1842 dbSNP
rs1352627170 1843 dbSNP
rs1280065410 1851 dbSNP
rs1001010288 1854 dbSNP
rs1409201323 1857 dbSNP
rs903635528 1874 dbSNP
rs1349886371 1887 dbSNP
rs1300748114 1888 dbSNP
rs114195341 1891 dbSNP
rs184658698 1896 dbSNP
rs1303022398 1903 dbSNP
rs200467804 1914 dbSNP
rs1314735171 1919 dbSNP
rs891009765 1920 dbSNP
rs1359991906 1931 dbSNP
rs537416872 1932 dbSNP
rs1051455379 1937 dbSNP
rs1220075512 1957 dbSNP
rs1263791397 1969 dbSNP
rs9893202 1979 dbSNP
rs1488171407 1983 dbSNP
rs9984 1984 dbSNP
rs14823 1987 dbSNP
rs929948824 2016 dbSNP
rs1191810324 2019 dbSNP
rs1404136316 2022 dbSNP
rs1269818459 2025 dbSNP
rs1413115562 2028 dbSNP
rs1410688345 2029 dbSNP
rs1178424268 2050 dbSNP
rs1381229812 2052 dbSNP
rs1159590524 2058 dbSNP
rs1163228488 2062 dbSNP
rs1422089749 2062 dbSNP
rs1349785069 2066 dbSNP
rs1458008061 2067 dbSNP
rs1056506102 2069 dbSNP
rs939573809 2073 dbSNP
rs768312955 2075 dbSNP
rs574438069 2077 dbSNP
rs150734978 2079 dbSNP
rs192752194 2091 dbSNP
rs1243714907 2092 dbSNP
rs34947813 2093 dbSNP
rs12674 2096 dbSNP
rs1322250176 2097 dbSNP
rs1222476527 2102 dbSNP
rs1267239055 2118 dbSNP
rs1456610058 2121 dbSNP
rs1198199165 2123 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 9110.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uaguuccAGGCGACACUUGUGc 5'
                 |||    ||||||| 
Target 5' cuucuuaUCC----UGAACACu 3'
 		9 - 26
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uaguuccAGGCGACACUUGUGc 5'
                 |||    ||||||| 
Target 5' cuucuuaUCC----UGAACACu 3'
 		9 - 26
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7 PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000579925.1 | 3UTR | UCACAUUGCUUCUUAUCCUGAACACUUGACACCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000579925.1 | 3UTR | UCACAUUGCUUCUUAUCCUGAACACUUGACACCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.497 6.7e-3 0.602 9.3e-4 24 Click to see details
GSE19350 CNS germ cell tumors -0.687 6.8e-3 -0.266 2.0e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.254 2.1e-2 0.286 1.1e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.313 7.3e-2 -0.404 2.8e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.311 1.5e-1 -0.220 2.4e-1 13 Click to see details
GSE17498 Multiple myeloma 0.161 1.6e-1 0.078 3.2e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.204 1.9e-1 -0.402 3.9e-2 20 Click to see details
GSE38226 Liver fibrosis -0.178 2.2e-1 -0.504 9.9e-3 21 Click to see details
GSE32688 Pancreatic cancer -0.089 3.1e-1 0.004 4.9e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.097 3.3e-1 -0.267 1.0e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.019 4.6e-1 -0.015 4.7e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.019 4.6e-1 -0.015 4.7e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
-0.019 4.6e-1 -0.015 4.7e-1 25 Click to see details
-0.019 4.6e-1 -0.015 4.7e-1 25 Click to see details
-0.019 4.6e-1 -0.015 4.7e-1 25 Click to see details
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064177 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT069736 FOXG1 forkhead box G1 2 4
MIRT086429 NABP1 nucleic acid binding protein 1 2 6
MIRT105334 SLC7A2 solute carrier family 7 member 2 2 4
MIRT110455 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT172998 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT196428 TAOK1 TAO kinase 1 2 14
MIRT325704 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT365670 TSC22D3 TSC22 domain family member 3 2 4
MIRT365873 XIAP X-linked inhibitor of apoptosis 2 2
MIRT404126 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT404626 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT405284 ARF1 ADP ribosylation factor 1 2 2
MIRT406099 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT446627 SDC3 syndecan 3 2 2
MIRT446906 RGS5 regulator of G protein signaling 5 2 2
MIRT461790 FXR2 FMR1 autosomal homolog 2 2 2
MIRT463982 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT464204 VGLL4 vestigial like family member 4 2 2
MIRT472790 MTMR4 myotubularin related protein 4 2 4
MIRT473485 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT481124 AZIN1 antizyme inhibitor 1 2 4
MIRT485060 SUCO SUN domain containing ossification factor 2 2
MIRT487343 HLA-DRA major histocompatibility complex, class II, DR alpha 2 2
MIRT491948 VPS52 VPS52, GARP complex subunit 2 2
MIRT497208 CDH7 cadherin 7 2 2
MIRT497476 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT528203 NELFE negative elongation factor complex member E 2 2
MIRT529255 TRIM4 tripartite motif containing 4 2 4
MIRT530096 PSAPL1 prosaposin like 1 (gene/pseudogene) 2 2
MIRT530597 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT534980 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT538326 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT561237 ZNF652 zinc finger protein 652 2 2
MIRT562035 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT563120 THAP5 THAP domain containing 5 2 2
MIRT563538 RBM41 RNA binding motif protein 41 2 2
MIRT566037 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT566505 PAWR pro-apoptotic WT1 regulator 2 2
MIRT566745 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT566850 LRRC58 leucine rich repeat containing 58 2 2
MIRT568077 CELF2 CUGBP Elav-like family member 2 2 2
MIRT576826 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT608870 NR2E1 nuclear receptor subfamily 2 group E member 1 2 4
MIRT611997 VAC14 Vac14, PIKFYVE complex component 2 2
MIRT614054 FAM89A family with sequence similarity 89 member A 2 2
MIRT618800 SPATA21 spermatogenesis associated 21 2 2
MIRT619389 RSPH3 radial spoke head 3 homolog 2 2
MIRT622282 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624026 EN2 engrailed homeobox 2 2 2
MIRT626000 MPEG1 macrophage expressed 1 2 2
MIRT641792 USP32 ubiquitin specific peptidase 32 2 2
MIRT651599 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT659662 CDC73 cell division cycle 73 2 2
MIRT663010 KIAA1586 KIAA1586 2 2
MIRT663561 ASTN2 astrotactin 2 2 2
MIRT669312 C16orf72 chromosome 16 open reading frame 72 2 2
MIRT685216 POTED POTE ankyrin domain family member D 2 2
MIRT695757 ZNF117 zinc finger protein 117 2 2
MIRT697909 TXNRD1 thioredoxin reductase 1 2 2
MIRT707181 RPH3A rabphilin 3A 2 2
MIRT707214 TRIM13 tripartite motif containing 13 2 2
MIRT707478 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT719507 LMAN2L lectin, mannose binding 2 like 2 2
MIRT755814 PARP1 poly(ADP-ribose) polymerase 1 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-124 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-124 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-124 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-124 Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
miR-124 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-124 Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 up-regualted
miR-124 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-124 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-124-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-124-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission