| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-3689d-1 |
| Genomic Coordinates | chr9: 134849609 - 134849682 |
| Description | Homo sapiens miR-3689d-1 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| pre-miRNA | hsa-mir-3689d-2 |
| Genomic Coordinates | chr9: 134850277 - 134850356 |
| Description | Homo sapiens miR-3689d-2 stem-loop |
| Comment | None |
| RNA Secondary Structure | |
| Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-3689d | |||||||||||||||||||||||||||||||||||||||
| Sequence | 2| GGGAGGUGUGAUCUCACACUCG |23 | |||||||||||||||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||
| Experiments | Illumina | |||||||||||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | MTMR10 | ||||||||||||||||||||
| Synonyms | - | ||||||||||||||||||||
| Description | myotubularin related protein 10 | ||||||||||||||||||||
| Transcript | NM_017762 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on MTMR10 | |||||||||||||||||||||
| 3'UTR of MTMR10 (miRNA target sites are highlighted) |
>MTMR10|NM_017762|3'UTR 1 AATAGGGTGTTTTCTGAACATTTTGAGGGAAGCTGTCAACTTTTTTCCTCTGAATTAACATTGCTAACCTAGGCGTTTGA 81 ATCTCTAATAACTTTATATGTAAGAATAATAGTTGGAATTTGCACTAATATTTAAAAACATGTTGAATCATGCTTCTTTC 161 ACACTTATTTTAAGAGAGATGTAAATTTTGTTCCTGTCCTCTTTCTGTCATTACAGGTCTGGCTCTTGTAACCGTGATCA 241 AACTGTTCATGTTGTCTGCTACATTTTTGTCTCCATCCATTTTTCCTACCACCTCCTGAAGGCTATCTGATAGTCAGTCA 321 CATTAGCAGCCCCAGGCAGCAGACAACAGGAAAGTTAGGAAATTTGTGTTTCGTGTCATTTTTAGGAGCATCTGATAAAA 401 CCTCCAGCAGGTTTTAGGAAGTATTCATGTATTTTTCTGGTTACTTTCTGTCGTCTCTAATTGAACTCACCTGATGAAGG 481 TTCAGTGTTCTGGGGCCAGAATTTATGATTTTAGATCACCTTCTTTGGAACCTTAGATCACTGTGTTTTGAAATCATGAG 561 TTTGCTTTTAACTTCATAGGGTCAACTTTAAAATGATATGCACTGTTAATTTTAAAGCATTTGCTGCAGATAATTAAACT 641 TAGAAGTGCCTTTGACTTTAGGATACAAATATTACAGAAGAAAATATAATTTCACTTTTTAAAATTGGGGTGGGAAAATC 721 CCATTGCATATTTGAAATAGGCTTTTCATACTAAGCTTCATAGCCAGGAGTCCCCAGAGTCTTGTTCCTCTGAAAGCCAC 801 TGGGGAGTGGCCTCTGGGGTGCTGATTCCACAGAGGTGTATGCTGTAGACAGGAGAGTGCCATCTATGCCAAAACTCGCC 881 CTCAAAAACAAACAAGGCTTGCTGGGAGGCGTGCTGGGCTTGGCCATCAGTATTTCCAGTGTGGTAAACTATTGCTGGCA 961 CTTCCCCCTGGAAATAACTAATGAGGTTACGAGTTGGGCACCTGCACAGATGTCCTTCTCTCATAGTTCCTAATGCTTAG 1041 GAATAGAGGAGAAATAAAAAAATGGATTCTCTCAAAACACTGCCATTTGAATAGCGACAGAAGTGCTCCCCCAGCCCCCA 1121 ACTTTGGACAGCAAAGTTGAGGAGAATGAGCAGACACAGTTGTTTGCTTGATCTGAATCTCTCTAAAGTAAAGTATTTCC 1201 AAACTGTGTGACAAGAGCCTACCTACCACTGTAGCGGTCAAAGCTGAAGCTTCTTACAGCAGTGAAACGGGGCACCACCT 1281 CCCCCACACTCCTCATTCCCCGCTTAAAACATGGATACTTTCAAATTTGACTGTTTCTTAAACTGCCATCCTAAGATATG 1361 GAAAATTTTTATAGTAAAGTGTCTAGTTAGCTTATTTCCTTTTCTAAAACAAGTGTTTTCAAGATAACTGTATTTTACCT 1441 TTATATGTACTGAATAGCTGTTTCTTTTTGAATTATTTGCCTTTTAAAATTTGATAATGTCTCTGGATATAACAGGACAG 1521 GAGTTCTTAAAAAATATCTTAAGAAATTCACTTTATGGGTAAACCCAAGGTTTTTGCCAACTTGTTGCCTAGAAAATAAG 1601 GGCTAGTTTCAGTTTATACAAATAGAATTATTAAACATTTTACAGTCCTTGATTAGAAACCAGACCCAATCTCCTTATAA 1681 CACCACAGCGTATCCTGCCATTGACAGTGTAATCACAATTCTCCCTTTTTCATTTAGCTGCTTTTTTATTATTACTAAAT 1761 GTTTTGGATTGAGCATTTTTCCCTCTGTAATTTTCTTCCTTCACGTTTATTTTAACTCTTGTAGTATTTTATTGTTGTTA 1841 ATTTACAAGTTTAAAAATATTAGGTACTATTAATAATGGTTAAAAATAGAAAAATGCATATTTTTGTATGATAATCAAAT 1921 GTAAAATACTTTTATTTTTGCTGGACAGTTGTTATATCATGATTATTGTGCTACAGTTTATTGTGCATAATATGAAAAAC 2001 AACTATGACAGCCTTCAGTCGGGCCAGGGTGAAGCTGCTTATACCACCTCTGCCGTCAGAGGGACATGTGGTGACAGCAG 2081 TGGTGTGGCTGCACAGGGCGCACTAGAGAGAGCTCAGCACCCCTGCTGCCCGCCAGCAGAGCCCGTGCTGAGGGAATGCC 2161 GCACAGATGCTGATGCACTGGGTGAAATTTCTAGTATTGAACGTAAAGGTGTACAGTGTCTTGCTGTTATTTTATGATGG 2241 AAACTGATTTTGAAACCAAAAATAGCTAACTAACTTTATTTAAGGAAAGGATATTAATTTGTACTAACAGAGGGTGAAAG 2321 CTGTTCACATTTGTCAACAAAATCTGCTTGCTGCAGTAGTAACCTCAAGTGGTTAAAACTTGATTTCCCGAGAAAACTAA 2401 AACCTTTGTGCCTAAAATTGATGACTTGAGTTCAAGTGGGATGAGCAAGAAGATGTGTTATCTTGTTGTTCAACAGTATT 2481 GAATGTGAAGGAAATTTTGATGGCTTAATAAAATTCCACAGCGACTGTTAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 54893.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293S |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
| Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10
PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM1084065 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
| Location of target site | ENST00000435680.1 | 3UTR | AGCAGGCGGAGGUUGCAGUGAGCCGAGAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000435680.1 | 3UTR | CCUCCCGGGUUCACGCCAUCCUCCUGCCUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000435680.1 | 3UTR | CCUCCCGGGUUCACGCCAUCCUCCUGCCUCAGCCUCCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
231 hsa-miR-3689d Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT059166 | TXNIP | thioredoxin interacting protein |  |
|
2 | 4 | ||||||
| MIRT080699 | KIAA1468 | KIAA1468 | |
|
2 | 2 | ||||||
| MIRT218770 | CDKN1A | cyclin dependent kinase inhibitor 1A | |
|
2 | 2 | ||||||
| MIRT278059 | KHNYN | KH and NYN domain containing | |
|
2 | 2 | ||||||
| MIRT345933 | EIF4A1 | eukaryotic translation initiation factor 4A1 | |
|
2 | 2 | ||||||
| MIRT366238 | VMA21 | VMA21, vacuolar ATPase assembly factor | |
|
2 | 2 | ||||||
| MIRT449689 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | |
|
2 | 2 | ||||||
| MIRT451149 | C19orf53 | chromosome 19 open reading frame 53 | |
|
2 | 2 | ||||||
| MIRT451266 | NDUFA11 | NADH:ubiquinone oxidoreductase subunit A11 | |
|
2 | 2 | ||||||
| MIRT451375 | C19orf43 | telomerase RNA component interacting RNase | |
|
2 | 2 | ||||||
| MIRT451570 | CIAPIN1 | cytokine induced apoptosis inhibitor 1 | |
|
2 | 2 | ||||||
| MIRT451585 | HIRIP3 | HIRA interacting protein 3 | |
|
2 | 2 | ||||||
| MIRT451614 | MEIS3P1 | Meis homeobox 3 pseudogene 1 | |
|
2 | 2 | ||||||
| MIRT451763 | ZNF611 | zinc finger protein 611 | |
|
2 | 6 | ||||||
| MIRT452383 | LY6E | lymphocyte antigen 6 family member E | |
|
2 | 4 | ||||||
| MIRT452573 | ZFP69B | ZFP69 zinc finger protein B | |
|
2 | 2 | ||||||
| MIRT452735 | PTGES3L | prostaglandin E synthase 3 like | |
|
2 | 6 | ||||||
| MIRT452867 | LAX1 | lymphocyte transmembrane adaptor 1 | |
|
2 | 2 | ||||||
| MIRT452975 | CABP4 | calcium binding protein 4 | |
|
2 | 2 | ||||||
| MIRT453215 | CERS1 | ceramide synthase 1 | |
|
2 | 2 | ||||||
| MIRT453259 | PARP11 | poly(ADP-ribose) polymerase family member 11 | |
|
2 | 2 | ||||||
| MIRT453449 | GLG1 | golgi glycoprotein 1 | |
|
2 | 2 | ||||||
| MIRT453479 | PITPNM3 | PITPNM family member 3 | |
|
2 | 2 | ||||||
| MIRT453663 | CD207 | CD207 molecule | |
|
2 | 6 | ||||||
| MIRT453724 | RAP1GDS1 | Rap1 GTPase-GDP dissociation stimulator 1 | |
|
2 | 2 | ||||||
| MIRT453760 | RANGAP1 | Ran GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT454181 | AP1S3 | adaptor related protein complex 1 sigma 3 subunit | |
|
2 | 6 | ||||||
| MIRT454330 | PPARA | peroxisome proliferator activated receptor alpha | |
|
2 | 2 | ||||||
| MIRT454338 | CDKL1 | cyclin dependent kinase like 1 | |
|
2 | 2 | ||||||
| MIRT454427 | GTF2F1 | general transcription factor IIF subunit 1 | |
|
2 | 2 | ||||||
| MIRT454665 | FBXL18 | F-box and leucine rich repeat protein 18 | |
|
2 | 2 | ||||||
| MIRT454825 | POLR2J3 | RNA polymerase II subunit J3 | |
|
2 | 2 | ||||||
| MIRT455130 | TBC1D25 | TBC1 domain family member 25 | |
|
2 | 2 | ||||||
| MIRT455166 | SUV39H1 | suppressor of variegation 3-9 homolog 1 | |
|
2 | 2 | ||||||
| MIRT455416 | RXRB | retinoid X receptor beta | |
|
2 | 2 | ||||||
| MIRT455668 | GLO1 | glyoxalase I | |
|
2 | 2 | ||||||
| MIRT455999 | CYP2C19 | cytochrome P450 family 2 subfamily C member 19 | |
|
2 | 2 | ||||||
| MIRT456446 | TMEM81 | transmembrane protein 81 | |
|
2 | 2 | ||||||
| MIRT456642 | NOS1AP | nitric oxide synthase 1 adaptor protein | |
|
2 | 2 | ||||||
| MIRT456728 | TMEM239 | transmembrane protein 239 | |
|
2 | 2 | ||||||
| MIRT457131 | ASPH | aspartate beta-hydroxylase | |
|
2 | 2 | ||||||
| MIRT457157 | MXRA7 | matrix remodeling associated 7 | |
|
2 | 2 | ||||||
| MIRT457358 | POFUT2 | protein O-fucosyltransferase 2 | |
|
2 | 2 | ||||||
| MIRT457458 | UNC119B | unc-119 lipid binding chaperone B | |
|
2 | 2 | ||||||
| MIRT457619 | UPK3BL | uroplakin 3B like 1 | |
|
2 | 2 | ||||||
| MIRT457692 | ZNF587 | zinc finger protein 587 | |
|
2 | 2 | ||||||
| MIRT457727 | SMOX | spermine oxidase | |
|
2 | 2 | ||||||
| MIRT457788 | VWA1 | von Willebrand factor A domain containing 1 | |
|
2 | 2 | ||||||
| MIRT457875 | THEM6 | thioesterase superfamily member 6 | |
|
2 | 4 | ||||||
| MIRT457909 | ZNF212 | zinc finger protein 212 | |
|
2 | 2 | ||||||
| MIRT458395 | ABCF1 | ATP binding cassette subfamily F member 1 | |
|
2 | 2 | ||||||
| MIRT458496 | MARVELD2 | MARVEL domain containing 2 | |
|
2 | 2 | ||||||
| MIRT458544 | CYP2B6 | cytochrome P450 family 2 subfamily B member 6 | |
|
2 | 2 | ||||||
| MIRT458577 | TCOF1 | treacle ribosome biogenesis factor 1 | |
|
2 | 2 | ||||||
| MIRT458732 | CES2 | carboxylesterase 2 | |
|
2 | 2 | ||||||
| MIRT458814 | ZNF843 | zinc finger protein 843 | |
|
2 | 2 | ||||||
| MIRT458931 | SAMD4B | sterile alpha motif domain containing 4B | |
|
2 | 2 | ||||||
| MIRT459341 | ZNF17 | zinc finger protein 17 | |
|
2 | 2 | ||||||
| MIRT459365 | MPLKIP | M-phase specific PLK1 interacting protein | |
|
2 | 6 | ||||||
| MIRT459572 | NLGN2 | neuroligin 2 | |
|
2 | 2 | ||||||
| MIRT460015 | DTX3L | deltex E3 ubiquitin ligase 3L | |
|
2 | 4 | ||||||
| MIRT460144 | ASB16 | ankyrin repeat and SOCS box containing 16 | |
|
2 | 2 | ||||||
| MIRT460653 | IGFBP4 | insulin like growth factor binding protein 4 | |
|
2 | 2 | ||||||
| MIRT460798 | VPS33A | VPS33A, CORVET/HOPS core subunit | |
|
2 | 2 | ||||||
| MIRT461058 | KCNK6 | potassium two pore domain channel subfamily K member 6 | |
|
2 | 4 | ||||||
| MIRT461458 | SLC19A3 | solute carrier family 19 member 3 | |
|
2 | 2 | ||||||
| MIRT461572 | SCO1 | SCO1, cytochrome c oxidase assembly protein | |
|
2 | 4 | ||||||
| MIRT461927 | TNFSF14 | TNF superfamily member 14 | |
|
2 | 2 | ||||||
| MIRT461953 | C3 | complement C3 | |
|
2 | 2 | ||||||
| MIRT462278 | KRR1 | KRR1, small subunit processome component homolog | |
|
2 | 2 | ||||||
| MIRT462744 | EFNB1 | ephrin B1 | |
|
2 | 2 | ||||||
| MIRT463136 | ZNF451 | zinc finger protein 451 | |
|
2 | 4 | ||||||
| MIRT463566 | ZBTB39 | zinc finger and BTB domain containing 39 | |
|
2 | 6 | ||||||
| MIRT463866 | WNT7B | Wnt family member 7B | |
|
2 | 2 | ||||||
| MIRT464326 | UST | uronyl 2-sulfotransferase | |
|
2 | 2 | ||||||
| MIRT464796 | UBE2F | ubiquitin conjugating enzyme E2 F (putative) | |
|
2 | 2 | ||||||
| MIRT465034 | TTC39C | tetratricopeptide repeat domain 39C | |
|
2 | 2 | ||||||
| MIRT466207 | TMED10 | transmembrane p24 trafficking protein 10 | |
|
2 | 2 | ||||||
| MIRT467007 | SSBP2 | single stranded DNA binding protein 2 | |
|
2 | 2 | ||||||
| MIRT467029 | SRSF1 | serine and arginine rich splicing factor 1 | |
|
2 | 4 | ||||||
| MIRT468001 | SKI | SKI proto-oncogene | |
|
2 | 2 | ||||||
| MIRT468031 | SIKE1 | suppressor of IKBKE 1 | |
|
2 | 6 | ||||||
| MIRT468575 | SERBP1 | SERPINE1 mRNA binding protein 1 | |
|
2 | 6 | ||||||
| MIRT468834 | RRM2 | ribonucleotide reductase regulatory subunit M2 | |
|
2 | 2 | ||||||
| MIRT468970 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT469450 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 6 | ||||||
| MIRT470888 | PLXND1 | plexin D1 | |
|
2 | 2 | ||||||
| MIRT470953 | PKM | pyruvate kinase, muscle | |
|
2 | 2 | ||||||
| MIRT471828 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT472590 | NACC1 | nucleus accumbens associated 1 | |
|
2 | 2 | ||||||
| MIRT472805 | MTMR12 | myotubularin related protein 12 | |
|
2 | 2 | ||||||
| MIRT472818 | MTMR10 | myotubularin related protein 10 | |
|
2 | 6 | ||||||
| MIRT472914 | MSN | moesin | |
|
2 | 2 | ||||||
| MIRT474558 | KLHDC3 | kelch domain containing 3 | |
|
2 | 2 | ||||||
| MIRT474716 | KIF13A | kinesin family member 13A | |
|
2 | 6 | ||||||
| MIRT475279 | TOR1AIP2 | torsin 1A interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT475300 | IFNLR1 | interferon lambda receptor 1 | |
|
2 | 2 | ||||||
| MIRT475759 | HDLBP | high density lipoprotein binding protein | |
|
2 | 2 | ||||||
| MIRT475786 | HDGF | heparin binding growth factor | |
|
2 | 2 | ||||||
| MIRT475933 | GXYLT2 | glucoside xylosyltransferase 2 | |
|
2 | 8 | ||||||
| MIRT476212 | GNS | glucosamine (N-acetyl)-6-sulfatase | |
|
2 | 2 | ||||||
| MIRT476238 | GNPNAT1 | glucosamine-phosphate N-acetyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT476799 | FNDC3B | fibronectin type III domain containing 3B | |
|
2 | 2 | ||||||
| MIRT477988 | DNAL1 | dynein axonemal light chain 1 | |
|
2 | 2 | ||||||
| MIRT478317 | DDN | dendrin | |
|
2 | 2 | ||||||
| MIRT479257 | CHSY1 | chondroitin sulfate synthase 1 | |
|
2 | 2 | ||||||
| MIRT479344 | CEP97 | centrosomal protein 97 | |
|
2 | 2 | ||||||
| MIRT479522 | CDCA4 | cell division cycle associated 4 | |
|
2 | 2 | ||||||
| MIRT479906 | CCDC117 | coiled-coil domain containing 117 | |
|
2 | 6 | ||||||
| MIRT481147 | AVL9 | AVL9 cell migration associated | |
|
2 | 6 | ||||||
| MIRT481735 | APH1A | aph-1 homolog A, gamma-secretase subunit | |
|
2 | 2 | ||||||
| MIRT482089 | ALG8 | ALG8, alpha-1,3-glucosyltransferase | |
|
2 | 2 | ||||||
| MIRT482389 | AEN | apoptosis enhancing nuclease | |
|
2 | 2 | ||||||
| MIRT483093 | TFPI | tissue factor pathway inhibitor | |
|
2 | 2 | ||||||
| MIRT484246 | ANK1 | ankyrin 1 | |
|
2 | 2 | ||||||
| MIRT484342 | EPN1 | epsin 1 | |
|
2 | 4 | ||||||
| MIRT489141 | C5orf38 | chromosome 5 open reading frame 38 | |
|
2 | 2 | ||||||
| MIRT489163 | MRPL12 | mitochondrial ribosomal protein L12 | |
|
2 | 4 | ||||||
| MIRT489547 | SOX11 | SRY-box 11 | |
|
2 | 4 | ||||||
| MIRT489780 | GRINA | glutamate ionotropic receptor NMDA type subunit associated protein 1 | |
|
2 | 2 | ||||||
| MIRT489799 | KRT80 | keratin 80 | |
|
2 | 6 | ||||||
| MIRT490535 | KIAA1715 | lunapark, ER junction formation factor | |
|
2 | 2 | ||||||
| MIRT492198 | SOCS1 | suppressor of cytokine signaling 1 | |
|
2 | 2 | ||||||
| MIRT492283 | SHISA6 | shisa family member 6 | |
|
2 | 4 | ||||||
| MIRT501059 | SMARCAD1 | SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 | |
|
2 | 4 | ||||||
| MIRT501094 | SLC5A6 | solute carrier family 5 member 6 | |
|
2 | 4 | ||||||
| MIRT503870 | CBS | cystathionine-beta-synthase | |
|
2 | 2 | ||||||
| MIRT507981 | BCL2L13 | BCL2 like 13 | |
|
2 | 4 | ||||||
| MIRT508125 | AMD1 | adenosylmethionine decarboxylase 1 | |
|
2 | 2 | ||||||
| MIRT508205 | SLC35E1 | solute carrier family 35 member E1 | |
|
2 | 2 | ||||||
| MIRT508385 | SPTBN2 | spectrin beta, non-erythrocytic 2 | |
|
2 | 4 | ||||||
| MIRT510308 | PDRG1 | p53 and DNA damage regulated 1 | |
|
2 | 2 | ||||||
| MIRT510462 | ZDHHC18 | zinc finger DHHC-type containing 18 | |
|
2 | 2 | ||||||
| MIRT512227 | ATXN3 | ataxin 3 | |
|
2 | 8 | ||||||
| MIRT512665 | STEAP3 | STEAP3 metalloreductase | |
|
2 | 2 | ||||||
| MIRT514184 | PGPEP1 | pyroglutamyl-peptidase I | |
|
2 | 2 | ||||||
| MIRT515053 | EBNA1BP2 | EBNA1 binding protein 2 | |
|
2 | 2 | ||||||
| MIRT515138 | ZNF799 | zinc finger protein 799 | |
|
2 | 4 | ||||||
| MIRT515452 | ZNF747 | zinc finger protein 747 | |
|
2 | 2 | ||||||
| MIRT515791 | COL4A3BP | collagen type IV alpha 3 binding protein | |
|
2 | 2 | ||||||
| MIRT515905 | AGTPBP1 | ATP/GTP binding protein 1 | |
|
2 | 2 | ||||||
| MIRT516129 | MRPS16 | mitochondrial ribosomal protein S16 | |
|
2 | 6 | ||||||
| MIRT516679 | ZNF860 | zinc finger protein 860 | |
|
2 | 4 | ||||||
| MIRT516750 | ZNF100 | zinc finger protein 100 | |
|
2 | 2 | ||||||
| MIRT516971 | OR7D2 | olfactory receptor family 7 subfamily D member 2 | |
|
2 | 2 | ||||||
| MIRT517491 | NPAP1 | nuclear pore associated protein 1 | |
|
2 | 2 | ||||||
| MIRT517774 | PROM2 | prominin 2 | |
|
2 | 2 | ||||||
| MIRT517938 | ZNF431 | zinc finger protein 431 | |
|
2 | 4 | ||||||
| MIRT518386 | ZNF250 | zinc finger protein 250 | |
|
2 | 2 | ||||||
| MIRT520621 | TMEM41B | transmembrane protein 41B | |
|
2 | 2 | ||||||
| MIRT521028 | SLC30A5 | solute carrier family 30 member 5 | |
|
2 | 2 | ||||||
| MIRT521454 | RAD51 | RAD51 recombinase | |
|
2 | 2 | ||||||
| MIRT521564 | PTPLB | 3-hydroxyacyl-CoA dehydratase 2 | |
1 | 1 | |||||||
| MIRT521581 | PTBP2 | polypyrimidine tract binding protein 2 | |
|
2 | 2 | ||||||
| MIRT522263 | NKRF | NFKB repressing factor | |
|
2 | 2 | ||||||
| MIRT522410 | MXI1 | MAX interactor 1, dimerization protein | |
|
2 | 2 | ||||||
| MIRT522543 | MED28 | mediator complex subunit 28 | |
|
2 | 6 | ||||||
| MIRT522915 | KCNE3 | potassium voltage-gated channel subfamily E regulatory subunit 3 | |
|
2 | 2 | ||||||
| MIRT523029 | IGF1 | insulin like growth factor 1 | |
|
2 | 2 | ||||||
| MIRT523854 | ESPL1 | extra spindle pole bodies like 1, separase | |
|
2 | 4 | ||||||
| MIRT524184 | DFFA | DNA fragmentation factor subunit alpha | |
|
2 | 2 | ||||||
| MIRT524520 | CDK19 | cyclin dependent kinase 19 | |
|
2 | 2 | ||||||
| MIRT524674 | C12orf5 | TP53 induced glycolysis regulatory phosphatase | |
|
2 | 2 | ||||||
| MIRT530257 | ZNF620 | zinc finger protein 620 | |
|
2 | 2 | ||||||
| MIRT540691 | BMP3 | bone morphogenetic protein 3 | |
|
2 | 2 | ||||||
| MIRT540976 | C17orf85 | nuclear cap binding subunit 3 | |
|
2 | 2 | ||||||
| MIRT545505 | NAP1L1 | nucleosome assembly protein 1 like 1 | |
|
2 | 2 | ||||||
| MIRT545631 | GGCX | gamma-glutamyl carboxylase | |
|
2 | 2 | ||||||
| MIRT547358 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | |
|
2 | 2 | ||||||
| MIRT550701 | MPL | MPL proto-oncogene, thrombopoietin receptor | |
|
2 | 4 | ||||||
| MIRT550717 | PMPCA | peptidase, mitochondrial processing alpha subunit | |
|
2 | 4 | ||||||
| MIRT551203 | NCR3LG1 | natural killer cell cytotoxicity receptor 3 ligand 1 | |
|
2 | 2 | ||||||
| MIRT553999 | SRGAP1 | SLIT-ROBO Rho GTPase activating protein 1 | |
|
2 | 4 | ||||||
| MIRT561081 | LLPH | LLP homolog, long-term synaptic facilitation | |
|
2 | 2 | ||||||
| MIRT563523 | TAF8 | TATA-box binding protein associated factor 8 | |
|
2 | 2 | ||||||
| MIRT564463 | SLC35E2 | solute carrier family 35 member E2 | |
|
2 | 2 | ||||||
| MIRT565233 | TRAF6 | TNF receptor associated factor 6 | |
|
2 | 2 | ||||||
| MIRT566618 | NKAP | NFKB activating protein | |
|
2 | 2 | ||||||
| MIRT569527 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | |
|
2 | 2 | ||||||
| MIRT569639 | QPCT | glutaminyl-peptide cyclotransferase | |
|
2 | 2 | ||||||
| MIRT570253 | SSPN | sarcospan | |
|
2 | 2 | ||||||
| MIRT570570 | OTUD7B | OTU deubiquitinase 7B | |
|
2 | 2 | ||||||
| MIRT570621 | MTF2 | metal response element binding transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT571098 | ISLR2 | immunoglobulin superfamily containing leucine rich repeat 2 | |
|
2 | 2 | ||||||
| MIRT575196 | Entpd4 | ectonucleoside triphosphate diphosphohydrolase 4 | |
|
2 | 2 | ||||||
| MIRT575554 | Cd99 | CD99 antigen | |
|
2 | 2 | ||||||
| MIRT575634 | Gnl3l | guanine nucleotide binding protein-like 3 (nucleolar)-like | |
|
2 | 2 | ||||||
| MIRT608267 | NOP14 | NOP14 nucleolar protein | |
|
2 | 2 | ||||||
| MIRT609314 | FXYD6 | FXYD domain containing ion transport regulator 6 | |
|
2 | 2 | ||||||
| MIRT627670 | RPL28 | ribosomal protein L28 | |
|
2 | 2 | ||||||
| MIRT631185 | TSPAN14 | tetraspanin 14 | |
|
2 | 2 | ||||||
| MIRT631964 | YIPF5 | Yip1 domain family member 5 | |
|
2 | 2 | ||||||
| MIRT632885 | GINM1 | glycoprotein integral membrane 1 | |
|
2 | 2 | ||||||
| MIRT642618 | CDKN3 | cyclin dependent kinase inhibitor 3 | |
|
2 | 2 | ||||||
| MIRT645609 | TSPAN6 | tetraspanin 6 | |
|
2 | 2 | ||||||
| MIRT662227 | PGBD4 | piggyBac transposable element derived 4 | |
|
2 | 2 | ||||||
| MIRT662329 | MYLK3 | myosin light chain kinase 3 | |
|
2 | 2 | ||||||
| MIRT662725 | LRRC3C | leucine rich repeat containing 3C | |
|
2 | 2 | ||||||
| MIRT665520 | USP14 | ubiquitin specific peptidase 14 | |
|
2 | 2 | ||||||
| MIRT666634 | RBMS2 | RNA binding motif single stranded interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT668969 | CNBP | CCHC-type zinc finger nucleic acid binding protein | |
|
2 | 2 | ||||||
| MIRT670925 | DESI1 | desumoylating isopeptidase 1 | |
|
2 | 2 | ||||||
| MIRT673939 | ZNF500 | zinc finger protein 500 | |
|
2 | 2 | ||||||
| MIRT674675 | PLCE1 | phospholipase C epsilon 1 | |
|
2 | 2 | ||||||
| MIRT675230 | MAK | male germ cell associated kinase | |
|
2 | 2 | ||||||
| MIRT680864 | MACC1 | MACC1, MET transcriptional regulator | |
|
2 | 2 | ||||||
| MIRT681047 | ZDBF2 | zinc finger DBF-type containing 2 | |
|
2 | 2 | ||||||
| MIRT681105 | CEP57L1 | centrosomal protein 57 like 1 | |
|
2 | 2 | ||||||
| MIRT683553 | HAVCR1 | hepatitis A virus cellular receptor 1 | |
|
2 | 2 | ||||||
| MIRT684508 | C1orf174 | chromosome 1 open reading frame 174 | |
|
2 | 2 | ||||||
| MIRT684812 | BRIX1 | BRX1, biogenesis of ribosomes | |
|
2 | 2 | ||||||
| MIRT685981 | CCDC77 | coiled-coil domain containing 77 | |
|
2 | 2 | ||||||
| MIRT686709 | TBC1D19 | TBC1 domain family member 19 | |
|
2 | 2 | ||||||
| MIRT686867 | SLC25A32 | solute carrier family 25 member 32 | |
|
2 | 2 | ||||||
| MIRT688908 | C11orf84 | chromosome 11 open reading frame 84 | |
|
2 | 2 | ||||||
| MIRT691208 | KLHL30 | kelch like family member 30 | |
|
2 | 2 | ||||||
| MIRT692298 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | |
|
2 | 2 | ||||||
| MIRT694380 | MTA1 | metastasis associated 1 | |
|
2 | 2 | ||||||
| MIRT696497 | COX6B1 | cytochrome c oxidase subunit 6B1 | |
|
2 | 2 | ||||||
| MIRT700686 | POLR3D | RNA polymerase III subunit D | |
|
2 | 2 | ||||||
| MIRT701088 | PAPOLG | poly(A) polymerase gamma | |
|
2 | 2 | ||||||
| MIRT703373 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | |
|
2 | 2 | ||||||
| MIRT706189 | SAR1B | secretion associated Ras related GTPase 1B | |
|
2 | 2 | ||||||
| MIRT706648 | SMIM19 | small integral membrane protein 19 | |
|
2 | 2 | ||||||
| MIRT709466 | KRTAP19-1 | keratin associated protein 19-1 | |
|
2 | 2 | ||||||
| MIRT709699 | DMWD | DM1 locus, WD repeat containing | |
|
2 | 2 | ||||||
| MIRT710693 | LYRM4 | LYR motif containing 4 | |
|
2 | 2 | ||||||
| MIRT713457 | DNAJC11 | DnaJ heat shock protein family (Hsp40) member C11 | |
|
2 | 2 | ||||||
| MIRT722409 | RARS2 | arginyl-tRNA synthetase 2, mitochondrial | |
|
2 | 2 | ||||||
| MIRT725391 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | |
|
2 | 2 | ||||||
| MIRT725548 | DNMT3A | DNA methyltransferase 3 alpha | |
|
2 | 2 | ||||||