miRTarBase - #MIRT474035


—
pre-miRNA Information
pre-miRNA hsa-mir-8055   
Genomic Coordinates chr8: 6622124 - 6622220
Description Homo sapiens miR-8055 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-8055
Sequence 65| CUUUGAGCACAUGAGCAGACGGA |87
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN29106641 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1387051240 1 dbSNP
rs773940954 2 dbSNP
rs1007521391 11 dbSNP
rs1425192922 13 dbSNP
rs1168057456 15 dbSNP
rs79123647 20 dbSNP
rs1049046267 21 dbSNP
rs561312343 22 dbSNP
Putative Targets

Gene Information
Gene Symbol LONRF1   
Synonyms RNF191
Description LON peptidase N-terminal domain and ring finger 1
Transcript NM_152271   
Expression
Putative miRNA Targets on LONRF1
3'UTR of LONRF1
(miRNA target sites are highlighted)		 
>LONRF1|NM_152271|3'UTR
   1 CTAACTCTTTGGATCTCCCTTTAAAGTGACCCTAATCTGGCTGCATTGATGGCCAGATTGTCTGCTGCCTTTGCACATCT
  81 AGTGCTGGTTTCAGAAATTTAATGAAACTTTTCTTTTTCCTTCGACCTCCTGAATCATGTGGTTCTGCAAATGAATACCT
 161 TCAACTAGGATTTAGACCACTAAGAACTTGCACAGAAAAACACGCATTGAATGTGTGTCGAACCTCTACATTGTGAAGTT
 241 GCACTATGTACCATACTCTAAAATGAAATAAGAACTCTTTATGTCTGTGAGAGAGTGTGTGTGTGTGTGTGCGTGCGTGT
 321 GTGCTTGTGGGGGTTGGGTAGTGTGTGTGTATTTTCTCTGGCTTTAAAATTTTAAAACAAACAAACAAAAAAGCCATAGA
 401 GAGCAGAACTTGCCGAGGGTCATTTATTGCCCAAGTTTACAAGAGTAGCGATACAAGTTTTTGCAAATTGAATTTGCCTC
 481 AGATATATCTGTCCTAATGCTTATATTTGCACAAGTATGTAAAATATCGTGTTGAGGATCATTCTTTGTTGGAAATACTG
 561 CTCTTGCTGAACTGTCTTGACCATTGACTATGACACAGTTTCTTATTTATGTAAATACTTGCATCACAGTGGCCGACAGG
 641 CATTGGATGCAGAACCTAGAGCCAGTTTTCAGGAACAATTGTAAACCTGACATGGTACTGTGCATCTATTCATAAAACAC
 721 TCAAAACTGTGAAAATATGGTTTACATTTAATTGTACATAAAGGTAAAGGGAGAACTCAATTCAGTACCAGTTAGTTTGT
 801 ACATTTTAGGGGGCTTTTCACATTAACTGCCCATTTGTGTAATTTATAGTTTGACATGATGTGTTTGTTTTAAAAAAAAA
 881 TGCATAGTATAAACCCATTAAGGATCTGGGAAAAGAGAAGAAGTTTAATATAGAACTAAGCTTTTAAAGTTTGTTTTTGT
 961 TTTTAATTCTGGTCTCGGTGCAAATGTTAGTTATGCCTTATTCATATCACAGTTAGATCACCATGCTGCAACATGGTTTA
1041 TATTCATGCTGCCCTAGAAACTTTTGTAATTATTTGTTGCAAATTTGTGACTGTCCTTATTAACTTTCTTTTATGTAAGT
1121 AATTTGTAAAAGTTTCTTAAAATTTTTGCTTTTGCTTATTTAATTTTGAATAAAAGCTAAATTCCTAATACTTTTTCTTA
1201 AAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGCAGACGAGUA---CACGAGUUUc 5'
            | ||| :||||      |||||| 
Target 5' tgCATCTATTCATAAAACACTCAAAa 3'
 701 - 726 125.00 -8.70
2 
miRNA  3' agGCAGACG--AGUACACGA-GUUUc 5'
            | |:||:  |:|| ||:| |||| 
Target 5' aaCTTTTGTAATTATTTGTTGCAAAt 3'
 1059 - 1084 119.00 -5.50
3 
miRNA  3' agGCAG----ACGA--GUACACGAGUUUc 5'
            :|||    ||||  :|| ||| |||: 
Target 5' tcTGTCCTAATGCTTATATTTGCACAAGt 3'
 488 - 516 117.00 -14.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30529544 55 COSMIC
COSN8892577 60 COSMIC
COSN31539336 65 COSMIC
COSN31499322 90 COSMIC
COSN31583622 113 COSMIC
COSN31558550 123 COSMIC
COSN31570705 152 COSMIC
COSN28758168 170 COSMIC
COSN15361577 285 COSMIC
COSN31534274 294 COSMIC
COSN23192503 295 COSMIC
COSN31531483 645 COSMIC
COSN26602246 650 COSMIC
COSN21144998 652 COSMIC
COSN31608040 696 COSMIC
COSN31579088 741 COSMIC
COSN25946496 762 COSMIC
COSN31513358 871 COSMIC
COSN30172873 872 COSMIC
COSN28196103 922 COSMIC
COSN6911005 993 COSMIC
COSN31608043 1131 COSMIC
COSN31536703 1134 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs754497154 1 dbSNP
rs138890174 2 dbSNP
rs753356142 2 dbSNP
rs1247052956 4 dbSNP
rs774543452 5 dbSNP
rs373942325 7 dbSNP
rs1275883999 13 dbSNP
rs1218052967 15 dbSNP
rs762947153 17 dbSNP
rs1298867227 18 dbSNP
rs1231104259 19 dbSNP
rs202139816 26 dbSNP
rs1332170393 28 dbSNP
rs80200850 37 dbSNP
rs150255759 43 dbSNP
rs1218588101 45 dbSNP
rs376576528 46 dbSNP
rs372985198 48 dbSNP
rs371012705 51 dbSNP
rs1196548220 65 dbSNP
rs567310577 69 dbSNP
rs1440476017 72 dbSNP
rs1212021374 79 dbSNP
rs952826289 85 dbSNP
rs1477424702 87 dbSNP
rs1414130527 94 dbSNP
rs746883489 100 dbSNP
rs1477869107 102 dbSNP
rs1171626053 103 dbSNP
rs1399667686 105 dbSNP
rs1413101323 108 dbSNP
rs1336504937 113 dbSNP
rs1376478200 119 dbSNP
rs58497791 120 dbSNP
rs527605969 123 dbSNP
rs1409977039 124 dbSNP
rs1274450612 127 dbSNP
rs1343195201 130 dbSNP
rs1395140338 133 dbSNP
rs1280725929 134 dbSNP
rs1165853409 136 dbSNP
rs566638741 141 dbSNP
rs1019498624 145 dbSNP
rs994300296 147 dbSNP
rs1189042792 151 dbSNP
rs898664588 154 dbSNP
rs768341690 162 dbSNP
rs1447073077 164 dbSNP
rs1197607263 165 dbSNP
rs1375452600 174 dbSNP
rs777791897 178 dbSNP
rs999137693 184 dbSNP
rs1007137435 189 dbSNP
rs1419544722 191 dbSNP
rs1184081928 192 dbSNP
rs189230050 203 dbSNP
rs1021906750 204 dbSNP
rs1011391310 209 dbSNP
rs1272357386 212 dbSNP
rs1051179387 216 dbSNP
rs1194338666 219 dbSNP
rs894247899 220 dbSNP
rs1235606148 225 dbSNP
rs1273610714 228 dbSNP
rs1055524967 230 dbSNP
rs933770220 236 dbSNP
rs533183103 238 dbSNP
rs1232395781 242 dbSNP
rs773372228 243 dbSNP
rs906829624 246 dbSNP
rs902227364 248 dbSNP
rs1209199108 260 dbSNP
rs1042205340 271 dbSNP
rs1452850863 272 dbSNP
rs946591324 275 dbSNP
rs1334711348 278 dbSNP
rs1036027440 280 dbSNP
rs1442691188 281 dbSNP
rs1454721670 282 dbSNP
rs565233073 287 dbSNP
rs772353556 293 dbSNP
rs543939030 294 dbSNP
rs531561833 295 dbSNP
rs116604449 296 dbSNP
rs1376490432 296 dbSNP
rs771038651 296 dbSNP
rs1311133619 298 dbSNP
rs1470784186 298 dbSNP
rs921360271 299 dbSNP
rs971511701 301 dbSNP
rs1263675815 303 dbSNP
rs1232411051 305 dbSNP
rs1176808913 307 dbSNP
rs1213818159 308 dbSNP
rs975435396 310 dbSNP
rs1253793661 311 dbSNP
rs1253012940 312 dbSNP
rs1456134962 312 dbSNP
rs149483963 312 dbSNP
rs186016177 312 dbSNP
rs368922505 312 dbSNP
rs3839870 312 dbSNP
rs768169225 312 dbSNP
rs972807172 312 dbSNP
rs3802267 313 dbSNP
rs1373774587 314 dbSNP
rs1395311619 314 dbSNP
rs199526969 314 dbSNP
rs1310454744 316 dbSNP
rs1319768987 316 dbSNP
rs775331481 317 dbSNP
rs1276970525 320 dbSNP
rs1315534569 320 dbSNP
rs1251587411 325 dbSNP
rs954412396 325 dbSNP
rs1029339564 326 dbSNP
rs1200281401 327 dbSNP
rs998221211 331 dbSNP
rs967724980 332 dbSNP
rs547887254 333 dbSNP
rs1422939443 337 dbSNP
rs1021519567 345 dbSNP
rs778998003 347 dbSNP
rs1442392326 355 dbSNP
rs1371282771 357 dbSNP
rs1355380853 358 dbSNP
rs902174596 362 dbSNP
rs958495363 371 dbSNP
rs560445426 378 dbSNP
rs1438240295 382 dbSNP
rs1297518309 386 dbSNP
rs1348549583 386 dbSNP
rs1337755089 388 dbSNP
rs1010597525 390 dbSNP
rs1295808525 390 dbSNP
rs200233077 393 dbSNP
rs1407824839 398 dbSNP
rs1230648976 403 dbSNP
rs1034105724 404 dbSNP
rs545247913 408 dbSNP
rs1455690739 412 dbSNP
rs867503977 414 dbSNP
rs768674937 415 dbSNP
rs1487333231 417 dbSNP
rs1188412667 421 dbSNP
rs1054859675 422 dbSNP
rs190622882 429 dbSNP
rs1432777284 432 dbSNP
rs1174222735 434 dbSNP
rs1435162850 442 dbSNP
rs1036465298 443 dbSNP
rs1297500450 447 dbSNP
rs1358590008 448 dbSNP
rs1395755873 449 dbSNP
rs1288892349 450 dbSNP
rs1193296259 454 dbSNP
rs1487611461 457 dbSNP
rs1384658381 469 dbSNP
rs1243665692 470 dbSNP
rs769731306 472 dbSNP
rs1216182193 476 dbSNP
rs1004532734 480 dbSNP
rs937954239 484 dbSNP
rs1285904659 485 dbSNP
rs1283714183 487 dbSNP
rs757791406 490 dbSNP
rs527755695 494 dbSNP
rs1242704369 504 dbSNP
rs745857377 512 dbSNP
rs1488204183 514 dbSNP
rs1048609161 517 dbSNP
rs1255200296 518 dbSNP
rs1157878000 523 dbSNP
rs537954429 527 dbSNP
rs781079690 528 dbSNP
rs1046309773 529 dbSNP
rs1302031611 530 dbSNP
rs112107466 533 dbSNP
rs1363580669 535 dbSNP
rs1371345001 537 dbSNP
rs1039844513 540 dbSNP
rs562872629 548 dbSNP
rs918579036 553 dbSNP
rs7005881 556 dbSNP
rs1225913249 562 dbSNP
rs184478014 563 dbSNP
rs1321190328 565 dbSNP
rs551702763 566 dbSNP
rs1296953492 576 dbSNP
rs1211944939 579 dbSNP
rs1275257755 583 dbSNP
rs777370829 590 dbSNP
rs1437103237 593 dbSNP
rs967376289 598 dbSNP
rs1173044453 602 dbSNP
rs1178291929 605 dbSNP
rs758070127 605 dbSNP
rs1471072731 606 dbSNP
rs1177708791 613 dbSNP
rs1413033719 622 dbSNP
rs1403078147 626 dbSNP
rs985593043 630 dbSNP
rs752355927 634 dbSNP
rs1421846129 635 dbSNP
rs764859211 636 dbSNP
rs1353102828 639 dbSNP
rs1474998392 640 dbSNP
rs1260745966 643 dbSNP
rs1212994164 645 dbSNP
rs1485939055 649 dbSNP
rs958611129 658 dbSNP
rs1295160551 661 dbSNP
rs1207353025 666 dbSNP
rs1308902843 670 dbSNP
rs1295937601 676 dbSNP
rs752261874 678 dbSNP
rs1271230739 679 dbSNP
rs1439310081 686 dbSNP
rs1034220267 688 dbSNP
rs1236707633 691 dbSNP
rs1471749007 692 dbSNP
rs539249750 693 dbSNP
rs569046004 694 dbSNP
rs1477240767 695 dbSNP
rs1340355539 702 dbSNP
rs1168085419 703 dbSNP
rs549958390 708 dbSNP
rs141868070 709 dbSNP
rs1276666757 712 dbSNP
rs1329904406 722 dbSNP
rs1417198432 731 dbSNP
rs560910718 737 dbSNP
rs548948378 739 dbSNP
rs1315432032 755 dbSNP
rs574220076 757 dbSNP
rs1218137327 758 dbSNP
rs1268617999 761 dbSNP
rs192134395 762 dbSNP
rs893527145 769 dbSNP
rs188759613 770 dbSNP
rs1356351294 771 dbSNP
rs887415718 772 dbSNP
rs1002405298 773 dbSNP
rs1027652904 784 dbSNP
rs995753388 785 dbSNP
rs879723141 788 dbSNP
rs1190458408 790 dbSNP
rs1243366439 794 dbSNP
rs1475514472 798 dbSNP
rs867337637 803 dbSNP
rs1046776192 808 dbSNP
rs1039873685 812 dbSNP
rs1433323319 813 dbSNP
rs944187694 830 dbSNP
rs766904860 831 dbSNP
rs897179190 833 dbSNP
rs1475505261 839 dbSNP
rs1256642060 844 dbSNP
rs1037006186 847 dbSNP
rs1481364223 854 dbSNP
rs1041771598 855 dbSNP
rs941434265 857 dbSNP
rs1345460839 867 dbSNP
rs946043615 871 dbSNP
rs914620544 872 dbSNP
rs368557756 881 dbSNP
rs565391705 881 dbSNP
rs932847179 882 dbSNP
rs990143926 884 dbSNP
rs1447092457 887 dbSNP
rs1197720484 896 dbSNP
rs977431427 906 dbSNP
rs966962312 909 dbSNP
rs1195837720 911 dbSNP
rs1235463537 914 dbSNP
rs1336116206 917 dbSNP
rs1312715971 920 dbSNP
rs1394784536 928 dbSNP
rs1387223478 929 dbSNP
rs1323102539 930 dbSNP
rs1375681128 937 dbSNP
rs1443405972 941 dbSNP
rs937271851 948 dbSNP
rs866987671 962 dbSNP
rs13328386 963 dbSNP
rs957784601 965 dbSNP
rs1033426021 971 dbSNP
rs578080642 973 dbSNP
rs1461830610 976 dbSNP
rs761002158 977 dbSNP
rs1213936965 978 dbSNP
rs773631881 983 dbSNP
rs1253963561 993 dbSNP
rs1418923605 1004 dbSNP
rs1015093494 1010 dbSNP
rs1366095113 1015 dbSNP
rs1420776770 1017 dbSNP
rs983182093 1022 dbSNP
rs1392410989 1036 dbSNP
rs1463148124 1040 dbSNP
rs1326843271 1042 dbSNP
rs11542169 1045 dbSNP
rs993836474 1048 dbSNP
rs1389501357 1051 dbSNP
rs1309030696 1053 dbSNP
rs1336230499 1055 dbSNP
rs897713221 1057 dbSNP
rs951884508 1060 dbSNP
rs1027308853 1064 dbSNP
rs1244016294 1065 dbSNP
rs767733299 1070 dbSNP
rs563120225 1071 dbSNP
rs1176078858 1076 dbSNP
rs1290835434 1078 dbSNP
rs1456181057 1079 dbSNP
rs1213920772 1082 dbSNP
rs74584736 1083 dbSNP
rs573765062 1091 dbSNP
rs1480490921 1095 dbSNP
rs1194485887 1097 dbSNP
rs1018452675 1100 dbSNP
rs1213925656 1101 dbSNP
rs941381793 1108 dbSNP
rs888441192 1117 dbSNP
rs1018856 1123 dbSNP
rs1008360341 1128 dbSNP
rs1415696455 1132 dbSNP
rs1050298702 1139 dbSNP
rs932732729 1140 dbSNP
rs1372769512 1148 dbSNP
rs1265200953 1150 dbSNP
rs1396949105 1152 dbSNP
rs1243301546 1154 dbSNP
rs922779258 1156 dbSNP
rs1018855 1157 dbSNP
rs976916197 1163 dbSNP
rs1480837596 1164 dbSNP
rs891256136 1167 dbSNP
rs945638012 1170 dbSNP
rs1319207992 1174 dbSNP
rs118028869 1187 dbSNP
rs533768262 1191 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agGCAGACGAGUA---CACGAGUUUc 5'
            | ||| :||||      |||||| 
Target 5' --CAUCUAUUCAUAAAACACUCAAAa 3'
 		1 - 24
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000398246.3 | 3UTR | CAUCUAUUCAUAAAACACUCAAAACUGUGAAAAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
192 hsa-miR-8055 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT104178 PHTF2 putative homeodomain transcription factor 2 2 6
MIRT109489 KLHL15 kelch like family member 15 2 2
MIRT138601 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT207609 COX5B cytochrome c oxidase subunit 5B 2 2
MIRT246311 HIST2H2AA3 histone cluster 2 H2A family member a3 2 4
MIRT246323 HIST2H2AA4 histone cluster 2 H2A family member a4 2 4
MIRT267508 FEN1 flap structure-specific endonuclease 1 2 2
MIRT271002 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT378038 SMAD5 SMAD family member 5 2 4
MIRT442382 CLVS2 clavesin 2 2 2
MIRT443996 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444222 TMEM136 transmembrane protein 136 2 2
MIRT445870 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT463214 ZNF131 zinc finger protein 131 2 2
MIRT464523 UBXN2B UBX domain protein 2B 2 2
MIRT471509 PCGF3 polycomb group ring finger 3 2 6
MIRT474035 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT481566 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 2 2
MIRT485415 LZIC leucine zipper and CTNNBIP1 domain containing 2 8
MIRT485724 CALM2 calmodulin 2 2 2
MIRT500745 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT502790 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT503164 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT504842 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT506559 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT511372 IKZF3 IKAROS family zinc finger 3 2 6
MIRT522117 NUDT3 nudix hydrolase 3 2 4
MIRT523755 FBXO27 F-box protein 27 2 4
MIRT525160 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT537294 FZD5 frizzled class receptor 5 2 2
MIRT537493 FAM168B family with sequence similarity 168 member B 2 2
MIRT538375 CRIM1 cysteine rich transmembrane BMP regulator 1 2 2
MIRT539394 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT544124 PPIL1 peptidylprolyl isomerase like 1 2 2
MIRT547269 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT548034 GOLIM4 golgi integral membrane protein 4 2 2
MIRT551641 CCDC127 coiled-coil domain containing 127 2 2
MIRT552585 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT552605 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554174 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT556914 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT564288 MED26 mediator complex subunit 26 2 2
MIRT571375 TTPAL alpha tocopherol transfer protein like 2 4
MIRT572009 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT572339 CKAP2L cytoskeleton associated protein 2 like 2 4
MIRT572612 CNTLN centlein 2 2
MIRT572779 ZNF277 zinc finger protein 277 2 2
MIRT573258 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT573353 PDE3A phosphodiesterase 3A 2 4
MIRT573362 MAP2K6 mitogen-activated protein kinase kinase 6 2 2
MIRT574194 LMNB1 lamin B1 2 2
MIRT574453 RPS16 ribosomal protein S16 2 2
MIRT574849 C12orf73 chromosome 12 open reading frame 73 2 2
MIRT575356 Zxda zinc finger, X-linked, duplicated A 2 3
MIRT612192 CCDC77 coiled-coil domain containing 77 2 2
MIRT612974 GGCX gamma-glutamyl carboxylase 2 2
MIRT613749 UNKL unkempt family like zinc finger 2 2
MIRT614085 PDE4C phosphodiesterase 4C 2 2
MIRT614405 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT614441 WDR92 WD repeat domain 92 2 2
MIRT614518 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT614653 NIPAL3 NIPA like domain containing 3 2 2
MIRT614720 TEAD3 TEA domain transcription factor 3 2 2
MIRT615556 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT616636 LRAT lecithin retinol acyltransferase 2 4
MIRT617210 CERS4 ceramide synthase 4 2 2
MIRT618934 SF3A3 splicing factor 3a subunit 3 2 2
MIRT619995 C1orf64 steroid receptor associated and regulated protein 2 2
MIRT620819 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT621254 PDZD2 PDZ domain containing 2 2 2
MIRT622307 SETD5 SET domain containing 5 2 2
MIRT623324 MAN1C1 mannosidase alpha class 1C member 1 2 2
MIRT625066 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 2
MIRT625443 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT626182 SRFBP1 serum response factor binding protein 1 2 2
MIRT626701 TRIM65 tripartite motif containing 65 2 2
MIRT628925 TBRG4 transforming growth factor beta regulator 4 2 2
MIRT630883 SLC25A33 solute carrier family 25 member 33 2 2
MIRT631653 BRI3BP BRI3 binding protein 2 2
MIRT631696 C1QTNF6 C1q and TNF related 6 2 2
MIRT632864 GSPT1 G1 to S phase transition 1 2 2
MIRT635185 NFKBID NFKB inhibitor delta 2 2
MIRT636917 ZNF845 zinc finger protein 845 2 2
MIRT637048 RAB27A RAB27A, member RAS oncogene family 2 2
MIRT637599 ZNF554 zinc finger protein 554 2 2
MIRT638204 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT638839 CPE carboxypeptidase E 2 2
MIRT639005 ACO1 aconitase 1 2 2
MIRT640894 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT641402 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT642083 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT643179 HYPK huntingtin interacting protein K 2 2
MIRT644205 CBS cystathionine-beta-synthase 2 2
MIRT645453 ANKS6 ankyrin repeat and sterile alpha motif domain containing 6 2 2
MIRT645797 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT645960 TTF2 transcription termination factor 2 2 2
MIRT646334 CLIC6 chloride intracellular channel 6 2 2
MIRT646484 APBB3 amyloid beta precursor protein binding family B member 3 2 2
MIRT646611 SMOC2 SPARC related modular calcium binding 2 2 2
MIRT649392 SH2D4A SH2 domain containing 4A 2 2
MIRT650540 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT650679 CD82 CD82 molecule 2 2
MIRT652118 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT652588 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654807 PPT1 palmitoyl-protein thioesterase 1 2 2
MIRT655318 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT655411 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT659671 CD86 CD86 molecule 2 2
MIRT660190 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660883 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT661695 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT661765 BIVM basic, immunoglobulin-like variable motif containing 2 2
MIRT662787 TBC1D25 TBC1 domain family member 25 2 2
MIRT663733 ZNF285 zinc finger protein 285 2 2
MIRT663787 DDX53 DEAD-box helicase 53 2 2
MIRT664663 IMPA2 inositol monophosphatase 2 2 2
MIRT665702 TMX4 thioredoxin related transmembrane protein 4 2 2
MIRT667444 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT667946 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 2
MIRT668776 DAAM1 dishevelled associated activator of morphogenesis 1 2 4
MIRT669824 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT670398 ZXDA zinc finger, X-linked, duplicated A 2 3
MIRT670402 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671112 ZNF573 zinc finger protein 573 2 2
MIRT671129 CD226 CD226 molecule 2 2
MIRT671145 ANKRD9 ankyrin repeat domain 9 2 2
MIRT671315 ACTR1A ARP1 actin related protein 1 homolog A 2 2
MIRT671329 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671857 ZNF429 zinc finger protein 429 2 2
MIRT672009 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672054 KIAA0930 KIAA0930 2 2
MIRT672466 RTTN rotatin 2 2
MIRT672642 SLC25A16 solute carrier family 25 member 16 2 4
MIRT672660 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT672755 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672839 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT672917 LRRC2 leucine rich repeat containing 2 2 2
MIRT672983 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT673051 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT673078 AK1 adenylate kinase 1 2 2
MIRT673143 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673303 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT673319 THAP1 THAP domain containing 1 2 2
MIRT673339 SLC35F6 solute carrier family 35 member F6 2 2
MIRT673554 PLA2G16 phospholipase A2 group XVI 2 2
MIRT673656 ZNF440 zinc finger protein 440 2 2
MIRT673693 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT673720 EMCN endomucin 2 2
MIRT673840 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT673869 KLF2 Kruppel like factor 2 2 2
MIRT673888 DCTN6 dynactin subunit 6 2 2
MIRT674180 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT674579 SLC35B4 solute carrier family 35 member B4 2 2
MIRT674604 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674737 SLC16A1 solute carrier family 16 member 1 2 2
MIRT674824 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 2
MIRT674993 STRN3 striatin 3 2 2
MIRT675058 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT675072 CCR6 C-C motif chemokine receptor 6 2 2
MIRT675116 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT675158 YARS2 tyrosyl-tRNA synthetase 2 2 2
MIRT675254 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT675434 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT675687 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT675772 YIPF4 Yip1 domain family member 4 2 2
MIRT675883 SNAP29 synaptosome associated protein 29 2 2
MIRT677923 SLC35E1 solute carrier family 35 member E1 2 2
MIRT678991 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT679010 MTMR10 myotubularin related protein 10 2 2
MIRT679024 ZNF419 zinc finger protein 419 2 2
MIRT679392 IL10RB interleukin 10 receptor subunit beta 2 2
MIRT679407 GMCL1 germ cell-less, spermatogenesis associated 1 2 2
MIRT683745 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT689266 ZNF99 zinc finger protein 99 2 2
MIRT690502 MDM2 MDM2 proto-oncogene 2 2
MIRT700939 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT702073 PCDHB11 protocadherin beta 11 2 2
MIRT705020 CALU calumenin 2 2
MIRT706196 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706253 MKLN1 muskelin 1 2 2
MIRT706540 GJD2 gap junction protein delta 2 2 2
MIRT707358 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT707407 RRP7A ribosomal RNA processing 7 homolog A 2 2
MIRT710638 GLUL glutamate-ammonia ligase 2 2
MIRT714213 C10orf71 chromosome 10 open reading frame 71 2 2
MIRT715646 USP6NL USP6 N-terminal like 2 2
MIRT717751 KCNRG potassium channel regulator 2 2
MIRT720793 GCH1 GTP cyclohydrolase 1 2 2
MIRT722254 POLQ DNA polymerase theta 2 2
MIRT723765 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT724965 TNS1 tensin 1 2 2
MIRT736568 TP53INP1 tumor protein p53 inducible nuclear protein 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-8055 Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)

Error report submission