>LIMA1|NM_001113546|3'UTR
   1 CAAATTGCAATGATGCTGGGCCTTAAATTCATGTTAGTGTTAGCGAGCCACTGCCCTTTGTCAAAATGTGATGCACATAA
  81 GCAGGTATCCCAGCATGAAATGTAATTTACTTGGAAGTAACTTTGGAAAAGAATTCCTTCTTAAAATCAAAAACAAAACA
 161 AAAAAACACAAAAAACACATTCTAAATACTAGAGATAACTTTACTTAAATTCTTCATTTTAGCAGTGATGATATGCATAA
 241 GTGCTGTAAGGCTTGTAACTGGGGAAATATTCCACCTGATAATAGCCCAGATTCTACTGTATTCCCAAAAGGCAATATTA
 321 AGGTAGACAGATGATTAGTAGTATATTGTTACACACTATTTTGGAATTAGAGAACATACAGAAGGAATTTAGGGGCTTAA
 401 ACATTACGACTGAATGCACTTTAGTATAAAGGGCACAGTTTGTATATTTTTAAATGAATACCAATTTAATTTTTTAGTAT
 481 TTACCTGTTAAGAGATTATTTAGTCTTTAAATTTTTTAGGTTAATTTTCTTGCTGTGATATATATGAGGAATTTACTACT
 561 TTATGTCCTGCTCTCTAAACTACATCCTGAACTCGACGTCCTGAGGTATAATACAACAGAGCACTTTTTGAGGCAATTGA
 641 AAAACCAACCTACACTCTTCGGTGCTTAGAGAGATCTGCTGTCTCCCAAATAAGCTTTTGTATCTGCCAGTGAATTTACT
 721 GTACTCCAAATGATTGCTTTCTTTTCTGGTGATATCTGTGCTTCTCATAATTACTGAAAGCTGCAATATTTTAGTAATAC
 801 CTTCGGGATCACTGTCCCCCATCTTCCGTGTTAGAGCAAAGTGAAGAGTTTAAAGGAGGAAGAAGAAAGAACTGTCTTAC
 881 ACCACTTGAGCTCAGACCTCTAAACCCTGTATTTCCCTTATGATGTCCCCTTTTTGAGACACTAATTTTTAAATACTTAC
 961 TAGCTCTGAAATATATTGATTTTTATCACAGTATTCTCAGGGTGAAATTAAACCAACTATAGGCCTTTTTCTTGGGATGA
1041 TTTTCTAGTCTTAAGGTTTGGGGACATTATAAACTTGAGTACATTTGTTGTACACAGTTGATATTCCAAATTGTATGGAT
1121 GGGAGGGAGAGGTGTCTTAAGCTGTAGGCTTTTCTTTGTACTGCATTTATAGAGATTTAGCTTTAATATTTTTTAGAGAT
1201 GTAAAACATTCTGCTTTCTTAGTCTTACCTAGTCTGAAACATTTTTATTCAATAAAGATTTTAATTAAAATTTGAACTTT
1281 TCAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuaCCAUUACCAAGAGAACGAu 5' | ||| ||:||||||| Target 5' tagGTTAA---TTTTCTTGCTg 3'	517 - 535	156.00	-14.00
2	miRNA 3' uuACCAUUACCAAGAGA-ACGAu 5' ||||:| | ||| |||| Target 5' tcTGGTGA----TATCTGTGCTt 3'	745 - 763	122.00	-10.50
3	miRNA 3' uuaCCAUUACCAAGAGAA--CGAu 5' || |: || | |||| ||| Target 5' ggaGGGAGAGG-TGTCTTAAGCTg 3'	1122 - 1144	114.00	-10.10

Mutant ID	Mutant Position	Mutant Source
COSN31549680	20	COSMIC
COSN30102968	23	COSMIC
COSN30127884	36	COSMIC
COSN30500174	43	COSMIC
COSN30519911	51	COSMIC
COSN31601621	108	COSMIC
COSN31599229	131	COSMIC
COSN31560721	142	COSMIC
COSN30144445	148	COSMIC
COSN18747104	159	COSMIC
COSN30519510	212	COSMIC
COSN1148926	352	COSMIC
COSN5945638	604	COSMIC
COSN6616205	720	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1336017651	3	dbSNP
rs1308811694	5	dbSNP
rs1192583220	7	dbSNP
rs748625422	10	dbSNP
rs1191637353	11	dbSNP
rs1364809928	16	dbSNP
rs373388466	18	dbSNP
rs1426535965	20	dbSNP
rs769840083	30	dbSNP
rs1158108643	32	dbSNP
rs746814149	33	dbSNP
rs777671959	36	dbSNP
rs758451635	37	dbSNP
rs752660777	39	dbSNP
rs778346637	41	dbSNP
rs754509271	42	dbSNP
rs766072431	44	dbSNP
rs760201311	45	dbSNP
rs750813076	49	dbSNP
rs1047273659	53	dbSNP
rs1276193305	65	dbSNP
rs926088915	67	dbSNP
rs1405956146	71	dbSNP
rs557763648	73	dbSNP
rs1347708030	75	dbSNP
rs1044544874	77	dbSNP
rs1332419506	84	dbSNP
rs948780857	94	dbSNP
rs901405534	95	dbSNP
rs1041722444	102	dbSNP
rs1485241253	104	dbSNP
rs917334186	108	dbSNP
rs534688027	125	dbSNP
rs1265956374	126	dbSNP
rs565878967	131	dbSNP
rs1187867044	142	dbSNP
rs919298748	148	dbSNP
rs989213964	167	dbSNP
rs1165729693	176	dbSNP
rs1330369203	176	dbSNP
rs936440673	178	dbSNP
rs201225828	180	dbSNP
rs1300183961	181	dbSNP
rs972612475	184	dbSNP
rs868167823	185	dbSNP
rs1400465117	203	dbSNP
rs1177013723	207	dbSNP
rs1292632538	207	dbSNP
rs962624512	216	dbSNP
rs1229859814	224	dbSNP
rs1312981242	225	dbSNP
rs977879209	226	dbSNP
rs1426863355	236	dbSNP
rs1044370	237	dbSNP
rs1488312255	238	dbSNP
rs187574228	241	dbSNP
rs1233635890	246	dbSNP
rs1256085814	251	dbSNP
rs917834834	253	dbSNP
rs991184380	259	dbSNP
rs1407518676	269	dbSNP
rs1417496334	278	dbSNP
rs1160687914	286	dbSNP
rs567468343	314	dbSNP
rs1434209240	316	dbSNP
rs1006743192	323	dbSNP
rs953890376	325	dbSNP
rs9364	328	dbSNP
rs1449937249	329	dbSNP
rs997983366	340	dbSNP
rs1303153358	343	dbSNP
rs1257992780	346	dbSNP
rs1372345551	347	dbSNP
rs891446069	348	dbSNP
rs1237451128	353	dbSNP
rs1031341128	355	dbSNP
rs1224585744	363	dbSNP
rs1326267525	372	dbSNP
rs1000364771	375	dbSNP
rs904802097	376	dbSNP
rs530856969	377	dbSNP
rs1218988169	379	dbSNP
rs1314529526	385	dbSNP
rs1044513388	397	dbSNP
rs952790795	399	dbSNP
rs1025756268	402	dbSNP
rs1479882078	403	dbSNP
rs948875304	407	dbSNP
rs1203720402	408	dbSNP
rs1171914689	410	dbSNP
rs1443968182	412	dbSNP
rs896025077	415	dbSNP
rs565164129	421	dbSNP
rs1057460798	431	dbSNP
rs3794312	433	dbSNP
rs1337317992	438	dbSNP
rs929416366	440	dbSNP
rs368726386	442	dbSNP
rs973421343	444	dbSNP
rs941232807	446	dbSNP
rs559041020	452	dbSNP
rs1377270611	454	dbSNP
rs779759933	462	dbSNP
rs867791743	464	dbSNP
rs529123679	481	dbSNP
rs1272519154	492	dbSNP
rs985396742	492	dbSNP
rs1175139974	496	dbSNP
rs1369108495	503	dbSNP
rs954008451	509	dbSNP
rs889432306	510	dbSNP
rs1053883371	520	dbSNP
rs755663697	541	dbSNP
rs1200988331	559	dbSNP
rs1468158095	561	dbSNP
rs1197028921	567	dbSNP
rs1409013740	568	dbSNP
rs1179107305	570	dbSNP
rs976872377	572	dbSNP
rs1248485148	573	dbSNP
rs1437906966	575	dbSNP
rs1478407596	583	dbSNP
rs955817583	589	dbSNP
rs183299967	592	dbSNP
rs1042154872	594	dbSNP
rs1400784066	595	dbSNP
rs138900845	597	dbSNP
rs1209900957	598	dbSNP
rs79474948	600	dbSNP
rs1201955140	614	dbSNP
rs1351066554	624	dbSNP
rs1436636095	628	dbSNP
rs1270122528	634	dbSNP
rs1339166828	635	dbSNP
rs780922616	636	dbSNP
rs1221017624	647	dbSNP
rs904225483	648	dbSNP
rs1334641762	650	dbSNP
rs1237423779	651	dbSNP
rs1292347431	654	dbSNP
rs557558296	660	dbSNP
rs1215243453	661	dbSNP
rs1262374337	672	dbSNP
rs1476769500	673	dbSNP
rs1195764168	678	dbSNP
rs959565092	680	dbSNP
rs1474770827	682	dbSNP
rs150238660	700	dbSNP
rs984102620	710	dbSNP
rs3184122	720	dbSNP
rs191777026	721	dbSNP
rs757992397	727	dbSNP
rs1358078447	729	dbSNP
rs1057304531	737	dbSNP
rs1402354805	739	dbSNP
rs1299361759	740	dbSNP
rs74090094	749	dbSNP
rs965533513	752	dbSNP
rs1286169929	753	dbSNP
rs1376925592	755	dbSNP
rs1357397171	761	dbSNP
rs1223445877	766	dbSNP
rs530327773	768	dbSNP
rs1489332399	769	dbSNP
rs1218640909	778	dbSNP
rs569845402	800	dbSNP
rs1441602051	801	dbSNP
rs762254077	802	dbSNP
rs535967653	804	dbSNP
rs749836957	805	dbSNP
rs941994121	808	dbSNP
rs549937271	817	dbSNP
rs570031362	819	dbSNP
rs1053996219	820	dbSNP
rs1377889918	821	dbSNP
rs910593455	827	dbSNP
rs1159745396	828	dbSNP
rs985364148	830	dbSNP
rs76020374	834	dbSNP
rs922388123	869	dbSNP
rs949166130	877	dbSNP
rs1341453942	881	dbSNP
rs1441704085	881	dbSNP
rs1307377174	886	dbSNP
rs976630045	887	dbSNP
rs137999054	912	dbSNP
rs1286650424	915	dbSNP
rs1344142932	918	dbSNP
rs1184337742	925	dbSNP
rs955952221	931	dbSNP
rs1446483443	934	dbSNP
rs917728741	935	dbSNP
rs1055386561	936	dbSNP
rs9588	942	dbSNP
rs113893061	947	dbSNP
rs369182029	947	dbSNP
rs1440991199	961	dbSNP
rs1181732839	962	dbSNP
rs571614970	974	dbSNP
rs1486401315	975	dbSNP
rs937882265	984	dbSNP
rs978504999	986	dbSNP
rs1352591409	987	dbSNP
rs968348332	999	dbSNP
rs1329526737	1002	dbSNP
rs1022595187	1004	dbSNP
rs1379481578	1006	dbSNP
rs1447595366	1007	dbSNP
rs765295577	1017	dbSNP
rs960338743	1020	dbSNP
rs1230913541	1021	dbSNP
rs931298620	1022	dbSNP
rs1036241180	1034	dbSNP
rs35296054	1037	dbSNP
rs755086115	1040	dbSNP
rs1319343301	1041	dbSNP
rs1458776724	1050	dbSNP
rs1178873301	1055	dbSNP
rs1266011301	1056	dbSNP
rs141231876	1057	dbSNP
rs1430977757	1063	dbSNP
rs993670786	1065	dbSNP
rs1311926743	1066	dbSNP
rs1382771518	1067	dbSNP
rs1363968638	1070	dbSNP
rs75806702	1085	dbSNP
rs1037784863	1096	dbSNP
rs1378760831	1100	dbSNP
rs528355882	1108	dbSNP
rs972777799	1109	dbSNP
rs965865956	1114	dbSNP
rs1169063733	1118	dbSNP
rs1006341913	1119	dbSNP
rs1019721791	1127	dbSNP
rs1223831670	1128	dbSNP
rs186892814	1131	dbSNP
rs548678598	1132	dbSNP
rs766641034	1139	dbSNP
rs535980292	1141	dbSNP
rs1050417714	1142	dbSNP
rs544943633	1143	dbSNP
rs563226421	1146	dbSNP
rs1032554808	1172	dbSNP
rs932536516	1174	dbSNP
rs543656209	1175	dbSNP
rs1275999765	1181	dbSNP
rs577815937	1182	dbSNP
rs1198836452	1189	dbSNP
rs1264547210	1192	dbSNP
rs1001076977	1200	dbSNP
rs1205350558	1201	dbSNP
rs1211188148	1208	dbSNP
rs1268652502	1211	dbSNP
rs922557121	1219	dbSNP
rs1477748887	1221	dbSNP
rs760760709	1228	dbSNP
rs934492025	1229	dbSNP
rs902154142	1232	dbSNP
rs1192004746	1238	dbSNP
rs924481708	1242	dbSNP
rs1164302663	1254	dbSNP
rs564297290	1257	dbSNP
rs1013312333	1262	dbSNP
rs773745504	1265	dbSNP
rs896206470	1270	dbSNP
rs1488139173	1274	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.