miRTarBase - #MIRT474253


—
pre-miRNA Information
pre-miRNA hsa-mir-215   
Genomic Coordinates chr1: 220117853 - 220117962
Synonyms MIRN215, miRNA215, mir-215, MIR215
Description Homo sapiens miR-215 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-215-3p
Sequence 64| UCUGUCAUUUCUUUAGGCCAAUA |86
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs768393822 2 dbSNP
rs1345487830 5 dbSNP
rs757646667 7 dbSNP
rs754286532 11 dbSNP
rs749489380 17 dbSNP
rs1333471638 18 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LATS2   
Synonyms KPM
Description large tumor suppressor kinase 2
Transcript NM_014572   
Expression
Putative miRNA Targets on LATS2
3'UTR of LATS2
(miRNA target sites are highlighted)		 
>LATS2|NM_014572|3'UTR
   1 ATGGGGGCCAGGCACCCCCACCACTCGCTGCCTCCCAGGTCAGGGTCCCGGAGCCGGTGCCCTCACAGGCCAATAGGGAA
  81 GCCGAGGGCTGTTTTGTTTTAAATTAGTCCGTCGATTACTTCACTTGAAATTCTGCTCTTCACCAAGAAAACCCAAACAG
 161 GACACTTTTGAAAACAGGACTCAGCATCGCTTTCAATAGGCTTTTCAGGACCTTCACTGCATTAAAACAATATTTTTGAA
 241 AATTTAGTACAGTTTAGAAAGAGCACTTATTTTGTTTATATCCATTTTTTCTTACTAAATTATAGGGATTAACTTTGACA
 321 AATCATGCTGCTGTTATTTTCTACATTTGTATTTTATCCATAGCACTTATTCACATTTAGGAAAAGACATAAAAACTGAA
 401 GAACATTGATGAGAAATCTCTGTGCAATAATGTAAAAAAAAAAAAAGATAACACTCTGCTCAATGTCACGGAGACCATTT
 481 TATCCACACAATGGTTTTTGTTTTTTATTTTTTCCCATGTTTCAAAATTGTGATATAATGATATAATGTTAAAAGCTGCT
 561 TTTTTTGGCTTTTTGCATATCTAGTATAATAGGAAGTGTGAGCAAGGTGATGATGTGGCTGTGATTTCCGACGTCTGGTG
 641 TGTGGAGAGTACTGCATGAGCAGAGTTCTTCTATTATAAAATTACCATATCTTGCCATTCACAGCAGGTCCTGTGAATAC
 721 GTTTTTACTGAGTGTCTTTAAATGAGGTGTTCTAGACAGTGTGCTGATAATGTATTGTGCGGGTGACCTCTTCGCTATGA
 801 TTGTATCTCTTACTGTTTTGTTAAAGAAATGCAGATGTGTAACTGAGAAGTGATTTGTGTGTGTGTCTTGGTTGTGATTG
 881 GATTCTTTGGGGGGGGGGAACTGAAACATTTGTCATATACTGAACTTATATACATCAAAAGGGATTAATACAGCGATGCC
 961 AAAAAGTTTAATCACGGACACATGTCCGTTTCTGTAGTCCGTATGCTCTTTCATTCTTGGTAGAGCTGGTATGTGGAATG
1041 CCATACCTCTGACCCTACTACTTACCTTTTTACTGACAGACTGCCCACACTGAAAGCTTCAGTGAATGTTCTTAGTCCTG
1121 TTTTCTTCTGTTACTGTCAGGAAACTGAGTGATCTAATGGTTCTCTCACTTTTTTTTTGTTCTTTTAGTGTACTTTGAAG
1201 TATCAAATCTTAACTTGGTTTAAACAATACATATTCCTAACCTTTGTAAAAAAGCAAAGATTCTTCAAAATGACATTGAA
1281 ATAAAAAGTAAGCCATACGTATTTTCTTAGAAGTATAGATGTATGTGCGTGTATACACACACACACACACACACAGAGAT
1361 AAACACAATATTCCTTATTTCAAATTAGTATGATTCCTATTTAAAGTGATTTATATTTGAGTAAAAAGTTCAATTCTTTT
1441 TTGCTTTTTAAAAAATCTGATGCTTCATAATTTTCATTATATTATTCCACATATTTTTCCTTGAAGTTCTTAGCATAATG
1521 TATCCATTACTTAGTATATATCTAGGCAACAACACTTAGAAGTTTATCAGTGTTTAAACTAAAAAAATAAAGATTCCTGT
1601 GTACTGGTTTACATTTGTGTGAGTGGCATACTCAAGTCTGCTGTGCCTGTCGTCGTGACTGTCAGTATTCTCGCTATTTT
1681 ATAGTCGTGCCATGTTGTTACTCACAGCGCTCTGACATACTTTCATGTGGTAGGTTCTTTCTCAGGAACTCAGTTTAACT
1761 ATTATTTATTGATATATCATTACCTTTGAAAAGCTTCTACTGGCACAATTTATTATTAAAATTTTGAATCCAAAAAAAAA
1841 AAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auaaccGGAUUUCUUUACUGUcu 5'
                |:| |  ||||||||  
Target 5' aagattCTTCA--AAATGACAtt 3'
 1257 - 1277 133.00 -6.10
2 
miRNA  3' auAACCGGAUUUCUUUACUGUCu 5'
            |||  :|||||||||| ||| 
Target 5' ttTTG--TTAAAGAAATG-CAGa 3'
 816 - 835 129.00 -14.70
3 
miRNA  3' auaaccggauuucuuuACUGUCu 5'
                          |||||| 
Target 5' ctacttacctttttacTGACAGa 3'
 1058 - 1080 120.00 -11.62
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31506407 7 COSMIC
COSN26982223 12 COSMIC
COSN8407358 14 COSMIC
COSN26562092 15 COSMIC
COSN30538885 35 COSMIC
COSN30462759 41 COSMIC
COSN31561317 49 COSMIC
COSN13434189 56 COSMIC
COSN30454728 76 COSMIC
COSN30462694 77 COSMIC
COSN30185885 81 COSMIC
COSN26549419 83 COSMIC
COSN30540217 83 COSMIC
COSN30142777 89 COSMIC
COSN30538420 90 COSMIC
COSN26982222 114 COSMIC
COSN30184819 120 COSMIC
COSN32063002 362 COSMIC
COSN27377626 433 COSMIC
COSN31596886 629 COSMIC
COSN31585336 668 COSMIC
COSN6223373 703 COSMIC
COSN28733674 731 COSMIC
COSN31539185 780 COSMIC
COSN20110414 889 COSMIC
COSN30544847 975 COSMIC
COSN9743642 984 COSMIC
COSN31483590 988 COSMIC
COSN31488336 999 COSMIC
COSN31488282 1008 COSMIC
COSN8587354 1021 COSMIC
COSN22884079 1063 COSMIC
COSN31527746 1104 COSMIC
COSN31556832 1121 COSMIC
COSN28479455 1170 COSMIC
COSN31528175 1182 COSMIC
COSN27472309 1334 COSMIC
COSN20110408 1335 COSMIC
COSN7395202 1408 COSMIC
COSN31515480 1436 COSMIC
COSN23772252 1652 COSMIC
COSN26465567 1692 COSMIC
COSN31513965 1737 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757855419 1 dbSNP
rs1384081439 3 dbSNP
rs752216344 5 dbSNP
rs376786994 8 dbSNP
rs1379695730 9 dbSNP
rs1417176491 10 dbSNP
rs765143917 14 dbSNP
rs754974571 15 dbSNP
rs930516840 17 dbSNP
rs753597550 19 dbSNP
rs1167240658 21 dbSNP
rs1406164167 24 dbSNP
rs750967838 26 dbSNP
rs766149898 26 dbSNP
rs760418287 27 dbSNP
rs774568224 30 dbSNP
rs1442742306 32 dbSNP
rs764237058 34 dbSNP
rs763115573 37 dbSNP
rs775781939 41 dbSNP
rs746430074 43 dbSNP
rs777296126 44 dbSNP
rs771282680 45 dbSNP
rs1050983205 47 dbSNP
rs747337030 49 dbSNP
rs777423592 50 dbSNP
rs200590477 52 dbSNP
rs929781176 53 dbSNP
rs1297771457 54 dbSNP
rs919098637 55 dbSNP
rs567879730 56 dbSNP
rs1439905339 58 dbSNP
rs1320757603 59 dbSNP
rs1363660418 64 dbSNP
rs549129737 73 dbSNP
rs530303704 74 dbSNP
rs927064827 80 dbSNP
rs979774930 83 dbSNP
rs879166284 84 dbSNP
rs1302142555 94 dbSNP
rs1485039454 96 dbSNP
rs1464462917 97 dbSNP
rs549625457 106 dbSNP
rs985885356 110 dbSNP
rs377266289 111 dbSNP
rs181349235 113 dbSNP
rs1033182103 114 dbSNP
rs376920019 119 dbSNP
rs1425876999 133 dbSNP
rs189313724 137 dbSNP
rs1159620072 141 dbSNP
rs879039577 142 dbSNP
rs964809818 142 dbSNP
rs1428291691 145 dbSNP
rs1257278407 146 dbSNP
rs1181827898 150 dbSNP
rs925594364 153 dbSNP
rs979662572 156 dbSNP
rs775670145 159 dbSNP
rs1291934430 161 dbSNP
rs890468728 164 dbSNP
rs1021203991 168 dbSNP
rs1260136543 178 dbSNP
rs753082832 179 dbSNP
rs1286865383 188 dbSNP
rs960894394 194 dbSNP
rs1029499044 198 dbSNP
rs1199284042 200 dbSNP
rs1035539455 211 dbSNP
rs532791356 230 dbSNP
rs1238276855 233 dbSNP
rs562565936 234 dbSNP
rs78193659 238 dbSNP
rs1246747144 245 dbSNP
rs941215341 247 dbSNP
rs1474861264 251 dbSNP
rs1177563875 260 dbSNP
rs1409961274 270 dbSNP
rs750159534 278 dbSNP
rs1044182145 283 dbSNP
rs371767931 284 dbSNP
rs797001899 284 dbSNP
rs1394278193 297 dbSNP
rs761723150 302 dbSNP
rs1436016142 303 dbSNP
rs141606621 308 dbSNP
rs1355378798 309 dbSNP
rs1411034863 309 dbSNP
rs1281791980 314 dbSNP
rs897773120 324 dbSNP
rs1036274206 329 dbSNP
rs944565572 337 dbSNP
rs988518184 343 dbSNP
rs1223607532 346 dbSNP
rs566313872 370 dbSNP
rs934922653 378 dbSNP
rs1208782686 392 dbSNP
rs1445354429 392 dbSNP
rs184385215 404 dbSNP
rs926225072 405 dbSNP
rs1485298029 406 dbSNP
rs1182366596 422 dbSNP
rs1397707323 428 dbSNP
rs1166710037 432 dbSNP
rs1458070113 433 dbSNP
rs1369472924 434 dbSNP
rs1176431913 439 dbSNP
rs1449826951 447 dbSNP
rs199516698 447 dbSNP
rs576412359 447 dbSNP
rs978931442 447 dbSNP
rs1331410469 448 dbSNP
rs1243820538 454 dbSNP
rs1164499179 456 dbSNP
rs776302950 458 dbSNP
rs1017658215 463 dbSNP
rs1240493374 464 dbSNP
rs987524211 465 dbSNP
rs1457333339 466 dbSNP
rs954669991 467 dbSNP
rs1026270538 468 dbSNP
rs1211897584 468 dbSNP
rs1274969898 468 dbSNP
rs1357306974 469 dbSNP
rs540072640 470 dbSNP
rs1469660832 477 dbSNP
rs1242252367 480 dbSNP
rs548063380 491 dbSNP
rs1309833230 505 dbSNP
rs1417959100 507 dbSNP
rs371115757 507 dbSNP
rs897052450 507 dbSNP
rs1017283004 512 dbSNP
rs1239314965 513 dbSNP
rs1005357251 517 dbSNP
rs1050617480 521 dbSNP
rs1439166853 532 dbSNP
rs931700623 533 dbSNP
rs1374071823 535 dbSNP
rs1324946813 538 dbSNP
rs1387048575 544 dbSNP
rs1268559695 556 dbSNP
rs905700727 559 dbSNP
rs756968058 560 dbSNP
rs753549394 567 dbSNP
rs1469614900 569 dbSNP
rs1211609005 571 dbSNP
rs1251961767 572 dbSNP
rs978437974 577 dbSNP
rs1382723769 578 dbSNP
rs763808711 581 dbSNP
rs1052760601 584 dbSNP
rs1159835447 588 dbSNP
rs1420694376 592 dbSNP
rs1460157285 596 dbSNP
rs967010185 606 dbSNP
rs1439588281 608 dbSNP
rs1385940366 615 dbSNP
rs1384191828 617 dbSNP
rs1316513077 620 dbSNP
rs914171303 627 dbSNP
rs770756388 628 dbSNP
rs1378610985 629 dbSNP
rs988394547 630 dbSNP
rs961180035 632 dbSNP
rs182205821 633 dbSNP
rs926199863 645 dbSNP
rs1043714355 649 dbSNP
rs557813856 653 dbSNP
rs1281706896 657 dbSNP
rs1002294818 658 dbSNP
rs969421054 659 dbSNP
rs943515032 662 dbSNP
rs1188074952 664 dbSNP
rs763640510 666 dbSNP
rs760125990 671 dbSNP
rs1187662993 679 dbSNP
rs987637814 683 dbSNP
rs774883033 687 dbSNP
rs1157004351 689 dbSNP
rs373167364 691 dbSNP
rs1286431917 705 dbSNP
rs1384550928 706 dbSNP
rs1435390795 710 dbSNP
rs766767257 715 dbSNP
rs1357280955 716 dbSNP
rs1412924612 720 dbSNP
rs577971767 720 dbSNP
rs1336060849 721 dbSNP
rs796131175 725 dbSNP
rs1258533047 728 dbSNP
rs1352591339 734 dbSNP
rs1210942589 749 dbSNP
rs1351397874 770 dbSNP
rs897811954 780 dbSNP
rs763571852 781 dbSNP
rs1421197946 783 dbSNP
rs972066383 788 dbSNP
rs556592825 793 dbSNP
rs532695491 794 dbSNP
rs567792613 795 dbSNP
rs1233250512 799 dbSNP
rs1340307467 803 dbSNP
rs1330179468 805 dbSNP
rs1434190927 811 dbSNP
rs75027638 814 dbSNP
rs534437729 815 dbSNP
rs1362886438 830 dbSNP
rs748311543 835 dbSNP
rs533236710 837 dbSNP
rs1304651803 838 dbSNP
rs201940969 846 dbSNP
rs1419640531 857 dbSNP
rs895547681 858 dbSNP
rs1052870941 865 dbSNP
rs76157937 875 dbSNP
rs1359113512 877 dbSNP
rs998501949 885 dbSNP
rs1478369140 886 dbSNP
rs565240677 886 dbSNP
rs201912534 888 dbSNP
rs547093503 889 dbSNP
rs925740669 889 dbSNP
rs10659630 890 dbSNP
rs369490836 890 dbSNP
rs1051866612 891 dbSNP
rs567121317 891 dbSNP
rs1385700443 892 dbSNP
rs912875984 892 dbSNP
rs988814291 893 dbSNP
rs1225807987 894 dbSNP
rs1257988610 894 dbSNP
rs1215969840 895 dbSNP
rs939583185 895 dbSNP
rs963372531 896 dbSNP
rs1488303182 897 dbSNP
rs11414736 898 dbSNP
rs141414045 898 dbSNP
rs1435378825 899 dbSNP
rs1491330150 899 dbSNP
rs1491534091 899 dbSNP
rs36118704 899 dbSNP
rs796959487 899 dbSNP
rs1380062848 900 dbSNP
rs1235492948 901 dbSNP
rs1263711711 902 dbSNP
rs1215548917 912 dbSNP
rs189640223 914 dbSNP
rs969952446 915 dbSNP
rs1262747791 918 dbSNP
rs928124428 921 dbSNP
rs1193101454 924 dbSNP
rs1014070843 929 dbSNP
rs1475531438 930 dbSNP
rs1280595407 938 dbSNP
rs1411284985 950 dbSNP
rs959872016 954 dbSNP
rs1159333711 955 dbSNP
rs73441496 958 dbSNP
rs1253708727 963 dbSNP
rs1417298224 964 dbSNP
rs568783812 969 dbSNP
rs1027769914 971 dbSNP
rs904309445 975 dbSNP
rs550580964 976 dbSNP
rs1279241460 977 dbSNP
rs770558742 977 dbSNP
rs1224709316 982 dbSNP
rs507186 983 dbSNP
rs184497457 984 dbSNP
rs561488299 987 dbSNP
rs890418488 988 dbSNP
rs546386324 990 dbSNP
rs528273516 999 dbSNP
rs1415519616 1001 dbSNP
rs1028858545 1011 dbSNP
rs995995448 1016 dbSNP
rs1420585199 1018 dbSNP
rs1409666237 1019 dbSNP
rs904349662 1023 dbSNP
rs9552315 1025 dbSNP
rs909329969 1028 dbSNP
rs945788081 1032 dbSNP
rs1332714300 1034 dbSNP
rs981164801 1040 dbSNP
rs1476687785 1041 dbSNP
rs891465650 1046 dbSNP
rs1239619547 1047 dbSNP
rs1056759143 1049 dbSNP
rs948051507 1051 dbSNP
rs1350097473 1055 dbSNP
rs1232214203 1061 dbSNP
rs1276395223 1065 dbSNP
rs758257680 1065 dbSNP
rs1188211802 1071 dbSNP
rs928232991 1074 dbSNP
rs1441764222 1085 dbSNP
rs1234453401 1089 dbSNP
rs1456289205 1090 dbSNP
rs1177550464 1104 dbSNP
rs545800603 1111 dbSNP
rs1455175686 1122 dbSNP
rs1170339838 1126 dbSNP
rs981005627 1131 dbSNP
rs1425074803 1134 dbSNP
rs1199910816 1148 dbSNP
rs114728199 1150 dbSNP
rs769923703 1151 dbSNP
rs1256975579 1154 dbSNP
rs571906622 1158 dbSNP
rs1446543921 1160 dbSNP
rs1337908038 1168 dbSNP
rs1031918232 1170 dbSNP
rs1434365200 1171 dbSNP
rs1274411812 1173 dbSNP
rs7330843 1177 dbSNP
rs1197830379 1179 dbSNP
rs1275034801 1179 dbSNP
rs540713023 1179 dbSNP
rs1449481824 1182 dbSNP
rs748339386 1188 dbSNP
rs1469587623 1193 dbSNP
rs1196110726 1213 dbSNP
rs1245561171 1214 dbSNP
rs1475457412 1218 dbSNP
rs778787084 1219 dbSNP
rs1170104943 1222 dbSNP
rs1334789023 1227 dbSNP
rs1465416225 1230 dbSNP
rs1166159455 1231 dbSNP
rs1015422115 1232 dbSNP
rs1401326108 1241 dbSNP
rs544655177 1245 dbSNP
rs74750830 1248 dbSNP
rs1408395627 1251 dbSNP
rs954861347 1254 dbSNP
rs1415777355 1259 dbSNP
rs1163608141 1270 dbSNP
rs1028892665 1274 dbSNP
rs555897956 1275 dbSNP
rs997722038 1298 dbSNP
rs904379344 1299 dbSNP
rs781716101 1303 dbSNP
rs1021381178 1308 dbSNP
rs187086548 1313 dbSNP
rs891580139 1315 dbSNP
rs747572454 1321 dbSNP
rs1057274284 1323 dbSNP
rs573080931 1328 dbSNP
rs573375670 1329 dbSNP
rs753492271 1331 dbSNP
rs1472018135 1334 dbSNP
rs397751657 1335 dbSNP
rs1491027841 1336 dbSNP
rs1491322937 1336 dbSNP
rs74036493 1336 dbSNP
rs60614685 1337 dbSNP
rs1045359388 1340 dbSNP
rs1402489293 1342 dbSNP
rs942237949 1347 dbSNP
rs1196449960 1352 dbSNP
rs1399255177 1354 dbSNP
rs1452965081 1355 dbSNP
rs1242367558 1356 dbSNP
rs1283218963 1356 dbSNP
rs1293831171 1356 dbSNP
rs1341997674 1356 dbSNP
rs140094971 1356 dbSNP
rs1491552805 1356 dbSNP
rs202198238 1356 dbSNP
rs58156767 1356 dbSNP
rs67234801 1356 dbSNP
rs766937031 1356 dbSNP
rs1157095470 1358 dbSNP
rs1364593629 1358 dbSNP
rs1045165303 1360 dbSNP
rs1313359217 1360 dbSNP
rs1435446086 1360 dbSNP
rs1404324970 1367 dbSNP
rs948000115 1378 dbSNP
rs917925113 1388 dbSNP
rs558405378 1393 dbSNP
rs1241799247 1399 dbSNP
rs145325971 1405 dbSNP
rs1352284309 1413 dbSNP
rs940847893 1414 dbSNP
rs924579016 1415 dbSNP
rs1356294352 1419 dbSNP
rs977639423 1421 dbSNP
rs1200227590 1432 dbSNP
rs907981656 1433 dbSNP
rs569570393 1449 dbSNP
rs968594929 1455 dbSNP
rs1421423956 1456 dbSNP
rs987943057 1456 dbSNP
rs954753794 1457 dbSNP
rs921911246 1460 dbSNP
rs1175649959 1461 dbSNP
rs974641288 1469 dbSNP
rs1379297600 1479 dbSNP
rs968568564 1479 dbSNP
rs577874427 1481 dbSNP
rs1377794170 1485 dbSNP
rs1021492325 1490 dbSNP
rs1010102923 1491 dbSNP
rs985846046 1493 dbSNP
rs763871877 1495 dbSNP
rs956051223 1500 dbSNP
rs1440995354 1508 dbSNP
rs1035466894 1519 dbSNP
rs1302843816 1522 dbSNP
rs1029947435 1535 dbSNP
rs1309946792 1540 dbSNP
rs1003012282 1544 dbSNP
rs1233077848 1550 dbSNP
rs997169351 1553 dbSNP
rs1320385367 1563 dbSNP
rs905540679 1580 dbSNP
rs1044051336 1592 dbSNP
rs1351775071 1594 dbSNP
rs1324003548 1599 dbSNP
rs556095477 1601 dbSNP
rs1404499384 1604 dbSNP
rs550151935 1628 dbSNP
rs780671828 1635 dbSNP
rs752127840 1649 dbSNP
rs1160426323 1651 dbSNP
rs867954678 1652 dbSNP
rs184788550 1653 dbSNP
rs192739453 1654 dbSNP
rs908014682 1655 dbSNP
rs1246883582 1656 dbSNP
rs1222797063 1657 dbSNP
rs1051872678 1663 dbSNP
rs767119587 1667 dbSNP
rs1451440087 1672 dbSNP
rs1364823444 1673 dbSNP
rs1385752101 1675 dbSNP
rs1296889268 1676 dbSNP
rs1290003987 1681 dbSNP
rs1219519299 1686 dbSNP
rs1217181043 1687 dbSNP
rs1257889086 1689 dbSNP
rs921940913 1690 dbSNP
rs535233 1692 dbSNP
rs546300135 1701 dbSNP
rs968681687 1703 dbSNP
rs1488170670 1706 dbSNP
rs765536839 1708 dbSNP
rs989113844 1709 dbSNP
rs1012333520 1712 dbSNP
rs955916540 1715 dbSNP
rs1191434405 1716 dbSNP
rs1422568695 1719 dbSNP
rs1035902719 1730 dbSNP
rs751295450 1732 dbSNP
rs1424209944 1733 dbSNP
rs1166405302 1739 dbSNP
rs1347804262 1744 dbSNP
rs896604671 1746 dbSNP
rs1002633530 1772 dbSNP
rs1289008778 1776 dbSNP
rs1362995485 1779 dbSNP
rs1398634877 1781 dbSNP
rs1278130189 1783 dbSNP
rs1370029326 1788 dbSNP
rs1356462807 1794 dbSNP
rs1275718232 1799 dbSNP
rs1230410835 1804 dbSNP
rs1050345 1805 dbSNP
rs969755729 1835 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177602. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_4 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148 ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000382592.4 | 3UTR | CCAUACCUCUGACCCUACUACUUACCUUUUUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
96 hsa-miR-215-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058509 TEAD1 TEA domain transcription factor 1 2 2
MIRT445625 TMEM50A transmembrane protein 50A 2 2
MIRT449286 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT456702 LDB1 LIM domain binding 1 2 2
MIRT467723 SLC38A1 solute carrier family 38 member 1 2 2
MIRT474253 LATS2 large tumor suppressor kinase 2 2 2
MIRT481811 AP4E1 adaptor related protein complex 4 epsilon 1 subunit 2 2
MIRT491969 USP37 ubiquitin specific peptidase 37 2 2
MIRT513203 RFT1 RFT1 homolog 2 2
MIRT532737 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT535706 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT536138 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT536463 KLF12 Kruppel like factor 12 2 4
MIRT552615 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554011 SPIRE1 spire type actin nucleation factor 1 2 2
MIRT563259 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT571054 POLQ DNA polymerase theta 2 4
MIRT573556 TMEM120B transmembrane protein 120B 2 2
MIRT573772 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT575328 Fbxo6 F-box protein 6 2 2
MIRT575497 Sept3 septin 3 2 5
MIRT607051 IDS iduronate 2-sulfatase 2 2
MIRT607070 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607497 HEBP2 heme binding protein 2 2 2
MIRT607799 RHBDL2 rhomboid like 2 2 2
MIRT610832 COL9A1 collagen type IX alpha 1 chain 2 2
MIRT616853 DSG2 desmoglein 2 2 2
MIRT617154 C18orf42 A-kinase anchor inhibitor 1 2 2
MIRT620823 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT625698 OPTN optineurin 2 2
MIRT628082 KAT7 lysine acetyltransferase 7 2 2
MIRT633540 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634343 SGOL1 shugoshin 1 2 2
MIRT634605 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT636759 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637044 SEPT3 septin 3 2 7
MIRT637213 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT639634 ZSCAN23 zinc finger and SCAN domain containing 23 2 2
MIRT640818 GPR107 G protein-coupled receptor 107 2 2
MIRT641033 PITPNB phosphatidylinositol transfer protein beta 2 2
MIRT641545 MOCOS molybdenum cofactor sulfurase 2 2
MIRT642091 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT645528 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT647017 ADCY2 adenylate cyclase 2 2 2
MIRT648044 FADS6 fatty acid desaturase 6 2 2
MIRT648514 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648869 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT656722 LMLN leishmanolysin like peptidase 2 2
MIRT658260 FAXC failed axon connections homolog 2 2
MIRT659063 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT659364 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT660318 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT663345 ZNF74 zinc finger protein 74 2 2
MIRT663526 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663975 ZNF786 zinc finger protein 786 2 2
MIRT664354 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664473 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664975 TDRD1 tudor domain containing 1 2 2
MIRT665488 VPS53 VPS53, GARP complex subunit 2 2
MIRT667758 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT669552 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT670183 CCDC142 coiled-coil domain containing 142 2 2
MIRT671342 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671873 ZNF429 zinc finger protein 429 2 2
MIRT672018 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672068 KIAA0930 KIAA0930 2 2
MIRT672551 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT672849 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT672988 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT673088 AK1 adenylate kinase 1 2 2
MIRT673578 KDELC2 KDEL motif containing 2 2 2
MIRT674582 SLC35B4 solute carrier family 35 member B4 2 2
MIRT674999 STRN3 striatin 3 2 2
MIRT675596 ZNF106 zinc finger protein 106 2 2
MIRT675778 YIPF4 Yip1 domain family member 4 2 2
MIRT676029 C9orf69 transmembrane protein 250 2 2
MIRT679015 MTMR10 myotubularin related protein 10 2 2
MIRT679169 PSMB2 proteasome subunit beta 2 2 2
MIRT687413 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT688038 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT691644 SLC43A3 solute carrier family 43 member 3 2 2
MIRT695630 SLC26A2 solute carrier family 26 member 2 2 2
MIRT697562 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT699153 SMC1A structural maintenance of chromosomes 1A 2 2
MIRT699683 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT702177 LYRM4 LYR motif containing 4 2 2
MIRT706217 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT711243 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT712343 NLN neurolysin 2 2
MIRT716574 HOPX HOP homeobox 2 2
MIRT717443 TENM1 teneurin transmembrane protein 1 2 2
MIRT717759 KCNRG potassium channel regulator 2 2
MIRT717945 TUBD1 tubulin delta 1 2 2
MIRT718343 PURA purine rich element binding protein A 2 2
MIRT718773 ABHD15 abhydrolase domain containing 15 2 2
MIRT737073 FOXM1 forkhead box M1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-215 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-215 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-215 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-215 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-215 Furan NULL 8029 Quantitative real-time PCR liver 22079235 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-215 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-215 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-215 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-215-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HCT-116)
hsa-miR-215-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-215-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission