pre-miRNA Information
pre-miRNA hsa-mir-4291   
Genomic Coordinates chr9: 93819357 - 93819421
Description Homo sapiens miR-4291 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4291
Sequence 11| UUCAGCAGGAACAGCU |26
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1265713434 9 dbSNP
rs1433969451 12 dbSNP
rs1372852268 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIAA0226
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucgacaAGGACGACuu 5'
                ||||||||  
Target 5' caccucUCCUGCUGcu 3'
12 - 27
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001145642 | 3UTR | AGUUCUGGAGCUUCUGAGCCAGGCCUUUCUCAACCACCUCUCCUGCUGCUGAAACGGGGAUGGCGUUUUCCCUCUCCCUGUCCUGGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001145642 | 3UTR | GUUCUGGAGCUUCUGAGCCAGGCCUUUCUCAACCACCUCUCCUGCUGCUGAAACGGGGAUGGCGUUUUCCCUCUCCCUGUCCUGGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001145642 | 3UTR | UCUGGAGCUUCUGAGCCAGGCCUUUCUCAACCACCUCUCCUGCUGCUGAAACGGGGAUGGCGUUUUCCCUCUCCCUGUCCUGGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001145642 | 3UTR | GUUCUGGAGCUUCUGAGCCAGGCCUUUCUCAACCACCUCUCCUGCUGCUGAAACGGGGAUGGCGUUUUCCCUCUCCCUGUCCUGGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001145642 | 3UTR | GUUCUGGAGCUUCUGAGCCAGGCCUUUCUCAACCACCUCUCCUGCUGCUGAAACGGGGAUGGCGUUUUCCCUCUCCCUGUCCUGGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001145642 | 3UTR | AGUUCUGGAGCUUCUGAGCCAGGCCUUUCUCAACCACCUCUCCUGCUGCUGAAACGGGGAUGGCGUUUUCCCUCUCCCUGUCCUGGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000273582.5 | 3UTR | CCUUUCUCAACCACCUCUCCUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-4291 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102445 CALU calumenin 2 4
MIRT108677 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT125969 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT179018 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT379033 CDK6 cyclin dependent kinase 6 2 6
MIRT442473 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 2
MIRT442910 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT442979 ZNF736 zinc finger protein 736 2 2
MIRT445663 TNFSF15 TNF superfamily member 15 2 2
MIRT446237 FZD6 frizzled class receptor 6 2 2
MIRT448860 FAM49B family with sequence similarity 49 member B 2 2
MIRT455559 TRAF1 TNF receptor associated factor 1 2 2
MIRT459704 ZNF641 zinc finger protein 641 2 2
MIRT460608 FEM1A fem-1 homolog A 2 2
MIRT462251 LAMA4 laminin subunit alpha 4 2 2
MIRT462469 FIZ1 FLT3 interacting zinc finger 1 2 2
MIRT466656 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT466841 STX6 syntaxin 6 2 2
MIRT471403 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471517 PCGF3 polycomb group ring finger 3 2 2
MIRT471681 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT472858 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT474813 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT474931 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475814 HDGF heparin binding growth factor 2 2
MIRT480434 C17orf49 chromosome 17 open reading frame 49 2 2
MIRT480903 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT481478 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT484982 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT485019 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT485036 TMEM189 transmembrane protein 189 2 8
MIRT495074 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT496004 CD180 CD180 molecule 2 2
MIRT500675 TRIM37 tripartite motif containing 37 2 2
MIRT504544 ZNF417 zinc finger protein 417 2 6
MIRT506782 KLHL15 kelch like family member 15 2 6
MIRT507256 FGF2 fibroblast growth factor 2 2 6
MIRT507386 EN2 engrailed homeobox 2 2 2
MIRT512505 BTBD19 BTB domain containing 19 2 2
MIRT516903 CTSB cathepsin B 2 2
MIRT528124 PPP1R10 protein phosphatase 1 regulatory subunit 10 2 2
MIRT528874 ATF3 activating transcription factor 3 2 2
MIRT536091 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT541079 RLIM ring finger protein, LIM domain interacting 2 2
MIRT541099 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT545360 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT545831 ZNF367 zinc finger protein 367 2 4
MIRT547115 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547312 NPTN neuroplastin 2 2
MIRT547959 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT549943 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT550749 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT565145 TUBB2A tubulin beta 2A class IIa 2 2
MIRT571050 POLQ DNA polymerase theta 2 2
MIRT571361 ZNF45 zinc finger protein 45 2 2
MIRT610133 FOXI2 forkhead box I2 2 2
MIRT613145 DSE dermatan sulfate epimerase 2 2
MIRT613379 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT615752 C6 complement C6 2 2
MIRT616460 ADRA2B adrenoceptor alpha 2B 2 2
MIRT616719 FEM1B fem-1 homolog B 2 2
MIRT618312 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT631491 RASSF4 Ras association domain family member 4 2 2
MIRT643134 PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 2 2
MIRT643482 DISC1 disrupted in schizophrenia 1 2 2
MIRT649715 TWSG1 twisted gastrulation BMP signaling modulator 1 2 2
MIRT653542 SLC38A7 solute carrier family 38 member 7 2 2
MIRT666307 SLC22A3 solute carrier family 22 member 3 2 2
MIRT692005 NAP1L4 nucleosome assembly protein 1 like 4 2 2
MIRT696838 ARL2BP ADP ribosylation factor like GTPase 2 binding protein 2 2
MIRT698204 TMEM248 transmembrane protein 248 2 2
MIRT703316 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 2 2
MIRT709376 FAM13A family with sequence similarity 13 member A 2 2
MIRT710112 MED23 mediator complex subunit 23 2 2
MIRT711975 HOMER2 homer scaffolding protein 2 2 2
MIRT712275 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT714108 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT719113 MAML1 mastermind like transcriptional coactivator 1 2 2
MIRT719727 SLC39A11 solute carrier family 39 member 11 2 2
MIRT720018 TFAP2C transcription factor AP-2 gamma 2 2
MIRT720358 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT720372 NUDT3 nudix hydrolase 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4291 Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-4291 Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-4291 Paclitaxel 36314 NSC125973 approved resistant High Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-4291 Doxorubicin 31703 NSC123127 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-4291 Radioactivity Iodine resistant High Papillary Thyroid Cancer tissue
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-4291 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4291 Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission