>HSPA8|NM_006597|3'UTR
   1 GCCAACCAAGTGTAGATGTAGCATTGTTCCACACATTTAAAACATTTGAAGGACCTAAATTCGTAGCAAATTCTGTGGCA
  81 GTTTTAAAAAGTTAAGCTGCTATAGTAAGTTACTGGGCATTCTCAATACTTGAATATGGAACATATGCACAGGGGAAGGA
 161 AATAACATTGCACTTTATAAACACTGTATTGTAAGTGGAAAATGCAATGTCTTAAATAAAACTATTTAAAATTGGCACCA
 241 TAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuuaaucCAUCACCGUCACCUu 5' ||| || |||||| Target 5' aaacactGTATTGTAAGTGGAa 3'	179 - 200	127.00	-10.60
2	miRNA 3' uuuaauccAUCAC-CGUCACCUu 5' || || ||| ||| Target 5' atggaacaTA-TGCACAGGGGAa 3'	136 - 157	109.00	-7.90
3	miRNA 3' uuuaauccauCACCGUCAccuu 5' |||||||| Target 5' agcaaattctGTGGCAGTttta 3'	65 - 86	100.00	-10.66

Mutant ID	Mutant Position	Mutant Source
COSN30539561	45	COSMIC
COSN30461050	62	COSMIC
COSN30497963	66	COSMIC
COSN31558837	72	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1185473462	2	dbSNP
rs745311590	7	dbSNP
rs1239339597	10	dbSNP
rs913944272	10	dbSNP
rs772120884	13	dbSNP
rs757291509	14	dbSNP
rs759613624	17	dbSNP
rs1368544143	22	dbSNP
rs1293108282	23	dbSNP
rs773134309	29	dbSNP
rs769966077	31	dbSNP
rs778548782	31	dbSNP
rs370664775	35	dbSNP
rs1331802004	37	dbSNP
rs781510219	38	dbSNP
rs753753364	41	dbSNP
rs764153995	43	dbSNP
rs768944810	44	dbSNP
rs1423896740	46	dbSNP
rs1374737377	53	dbSNP
rs922486626	53	dbSNP
rs1434520321	62	dbSNP
rs560017021	63	dbSNP
rs964183600	67	dbSNP
rs372684210	71	dbSNP
rs547441737	71	dbSNP
rs1347768911	73	dbSNP
rs1415904448	73	dbSNP
rs1005343071	75	dbSNP
rs951102350	79	dbSNP
rs1443009857	82	dbSNP
rs1025341590	84	dbSNP
rs529283663	85	dbSNP
rs1452473099	86	dbSNP
rs1178995209	87	dbSNP
rs1391990310	89	dbSNP
rs1394193912	91	dbSNP
rs1452370511	91	dbSNP
rs868692668	94	dbSNP
rs1174182114	95	dbSNP
rs561827482	97	dbSNP
rs1485291654	100	dbSNP
rs1239946182	101	dbSNP
rs1057092732	102	dbSNP
rs543558826	103	dbSNP
rs1443315490	104	dbSNP
rs182718582	108	dbSNP
rs1280093969	111	dbSNP
rs1447127950	115	dbSNP
rs1324829566	116	dbSNP
rs1370665760	118	dbSNP
rs905332176	126	dbSNP
rs1043871315	136	dbSNP
rs946837276	137	dbSNP
rs892537836	145	dbSNP
rs1052470967	146	dbSNP
rs933956028	152	dbSNP
rs1199458308	154	dbSNP
rs1359976655	156	dbSNP
rs1286111505	159	dbSNP
rs1449054159	162	dbSNP
rs1200806326	164	dbSNP
rs1378128736	165	dbSNP
rs1475067588	166	dbSNP
rs1167893523	167	dbSNP
rs1425090856	168	dbSNP
rs1465719784	169	dbSNP
rs1163683014	170	dbSNP
rs1358850423	171	dbSNP
rs1312009835	173	dbSNP
rs191052844	174	dbSNP
rs922552371	176	dbSNP
rs1432698354	177	dbSNP
rs1372313459	178	dbSNP
rs1169154871	181	dbSNP
rs545188958	181	dbSNP
rs1326027666	182	dbSNP
rs1427338477	184	dbSNP
rs1416810735	185	dbSNP
rs1430577975	187	dbSNP
rs1276887613	188	dbSNP
rs1320004883	189	dbSNP
rs796876857	190	dbSNP
rs1183191874	191	dbSNP
rs1272768450	192	dbSNP
rs1354595083	194	dbSNP
rs1419165191	194	dbSNP
rs1472910442	201	dbSNP
rs1256421160	202	dbSNP
rs1209176096	203	dbSNP
rs1267858326	205	dbSNP
rs1484276296	207	dbSNP
rs4114918	210	dbSNP
rs139624482	211	dbSNP
rs553245570	222	dbSNP
rs909749273	224	dbSNP
rs1163501093	225	dbSNP
rs1359824121	226	dbSNP
rs983939510	227	dbSNP
rs1419481542	228	dbSNP
rs951133136	236	dbSNP
rs3168111	237	dbSNP
rs1025372949	240	dbSNP
rs992520894	243	dbSNP
rs1292788285	245	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.