pre-miRNA Information
pre-miRNA hsa-mir-3123   
Genomic Coordinates chr1: 241132272 - 241132346
Description Homo sapiens miR-3123 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3123
Sequence 49| CAGAGAAUUGUUUAAUC |65
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 + 241132323 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1453759221 1 dbSNP
rs968575171 5 dbSNP
rs979407933 9 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HSP90B1   
Synonyms ECGP, GP96, GRP94, HEL-S-125m, HEL35, TRA1
Description heat shock protein 90 beta family member 1
Transcript NM_003299   
Expression
Putative miRNA Targets on HSP90B1
3'UTR of HSP90B1
(miRNA target sites are highlighted)
>HSP90B1|NM_003299|3'UTR
   1 ATTATACTCTCACCATTTGGATCCTGTGTGGAGAGGGAATGTGAAATTTACATCATTTCTTTTTGGGAGAGACTTGTTTT
  81 GGATGCCCCCTAATCCCCTTCTCCCCTGCACTGTAAAATGTGGGATTATGGGTCACAGGAAAAAGTGGGTTTTTTAGTTG
 161 AATTTTTTTTAACATTCCTCATGAATGTAAATTTGTACTATTTAACTGACTATTCTTGATGTAAAATCTTGTCATGTGTA
 241 TAAAAATAAAAAAGATCCCAAATACTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26979413 3 COSMIC
COSN30524100 5 COSMIC
COSN30478645 12 COSMIC
COSN26979420 18 COSMIC
COSN8407299 34 COSMIC
COSN31584081 36 COSMIC
COSN30482464 40 COSMIC
COSN31525684 49 COSMIC
COSN31540101 67 COSMIC
COSN30155042 70 COSMIC
COSN31600346 118 COSMIC
COSN28838068 171 COSMIC
COSN28869751 171 COSMIC
COSN30100245 171 COSMIC
COSN31590166 247 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs200512715 12 dbSNP
rs1021883917 17 dbSNP
rs746244949 21 dbSNP
rs772484547 23 dbSNP
rs373539366 24 dbSNP
rs760121580 24 dbSNP
rs893521886 25 dbSNP
rs1245548028 26 dbSNP
rs1227169064 29 dbSNP
rs375456268 32 dbSNP
rs1188508186 36 dbSNP
rs768203454 51 dbSNP
rs769155689 53 dbSNP
rs202143765 54 dbSNP
rs761318721 55 dbSNP
rs764806676 58 dbSNP
rs773054301 61 dbSNP
rs1399801716 64 dbSNP
rs563743925 65 dbSNP
rs776486970 67 dbSNP
rs766319812 77 dbSNP
rs1363985190 81 dbSNP
rs751380940 82 dbSNP
rs761784666 86 dbSNP
rs754898383 88 dbSNP
rs1351444339 91 dbSNP
rs764978702 91 dbSNP
rs1233170856 98 dbSNP
rs1349268163 99 dbSNP
rs1051185 102 dbSNP
rs767452724 104 dbSNP
rs1201339345 106 dbSNP
rs1240376583 107 dbSNP
rs1438176598 110 dbSNP
rs750272740 110 dbSNP
rs1267793088 113 dbSNP
rs762786499 126 dbSNP
rs1190666814 129 dbSNP
rs1248739371 137 dbSNP
rs753869109 143 dbSNP
rs1191457625 145 dbSNP
rs11547719 147 dbSNP
rs1406607898 147 dbSNP
rs1198120741 149 dbSNP
rs1019475302 150 dbSNP
rs1375815469 150 dbSNP
rs757305028 158 dbSNP
rs778953037 159 dbSNP
rs961493484 162 dbSNP
rs1455911211 163 dbSNP
rs545777688 163 dbSNP
rs751765634 163 dbSNP
rs1172917061 178 dbSNP
rs746157201 181 dbSNP
rs758595515 187 dbSNP
rs1374826527 188 dbSNP
rs1020760458 192 dbSNP
rs780417558 196 dbSNP
rs926928249 199 dbSNP
rs1447398902 200 dbSNP
rs2307842 205 dbSNP
rs35780385 205 dbSNP
rs756402434 205 dbSNP
rs1299845436 207 dbSNP
rs1160438504 213 dbSNP
rs1417288497 222 dbSNP
rs1362784726 229 dbSNP
rs1176312607 234 dbSNP
rs1434552681 235 dbSNP
rs111996964 241 dbSNP
rs1330719757 248 dbSNP
rs1189870121 251 dbSNP
rs1490315160 257 dbSNP
rs1264499445 263 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cuAAUUUGUUAAGAgac 5'
            | ||:|||||||   
Target 5' guUCAAGCAAUUCU--- 3'
9 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cuAAUUUGUUAAGAGAc 5'
            | ||:||||||||| 
Target 5' guUCAAGCAAUUCUCUg 3'
9 - 25
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000299767.5 | 3UTR | CCUUCCGGGUUCAAGCAAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000299767.5 | 3UTR | CCUUCCGGGUUCAAGCAAUUCUCUGCCUCAGCCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
113 hsa-miR-3123 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058369 TBCEL tubulin folding cofactor E like 2 4
MIRT059816 EFNA1 ephrin A1 2 2
MIRT066850 TMEM19 transmembrane protein 19 2 2
MIRT071503 CALM1 calmodulin 1 2 6
MIRT073758 NUBP1 nucleotide binding protein 1 2 2
MIRT074324 TNRC6A trinucleotide repeat containing 6A 2 10
MIRT094805 LMNB1 lamin B1 2 2
MIRT099173 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT099545 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT122643 E2F3 E2F transcription factor 3 2 2
MIRT180918 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT192844 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT224984 BAG4 BCL2 associated athanogene 4 2 2
MIRT246065 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT357085 PRRC1 proline rich coiled-coil 1 2 2
MIRT378170 C5ORF51 chromosome 5 open reading frame 51 2 2
MIRT441636 KDM5A lysine demethylase 5A 2 2
MIRT441802 BCAS1 breast carcinoma amplified sequence 1 2 2
MIRT443019 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT443445 SERPINB4 serpin family B member 4 2 2
MIRT443661 SERPINB3 serpin family B member 3 2 2
MIRT443776 STS steroid sulfatase 2 2
MIRT444663 TSPAN14 tetraspanin 14 2 2
MIRT444924 KIAA1522 KIAA1522 2 2
MIRT445378 FOXO1 forkhead box O1 2 2
MIRT447920 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT449202 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT449713 TSPYL1 TSPY like 1 2 2
MIRT450403 TMEM47 transmembrane protein 47 2 2
MIRT450787 PAPOLG poly(A) polymerase gamma 2 2
MIRT451381 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT452507 WDR1 WD repeat domain 1 2 2
MIRT453264 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT454642 FAM83H family with sequence similarity 83 member H 2 2
MIRT455513 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT456709 LDB1 LIM domain binding 1 2 2
MIRT457231 AP3D1 adaptor related protein complex 3 delta 1 subunit 2 2
MIRT459235 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT460553 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT461424 CTSL2 cathepsin V 2 3
MIRT462869 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT467178 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT469233 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT474125 LIPC lipase C, hepatic type 2 2
MIRT475509 HSP90B1 heat shock protein 90 beta family member 1 2 4
MIRT478134 DHX36 DEAH-box helicase 36 2 2
MIRT481326 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 2 2
MIRT482003 AMOTL2 angiomotin like 2 2 2
MIRT482230 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT483436 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483824 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT492051 TNFSF9 TNF superfamily member 9 2 2
MIRT494114 DLX6 distal-less homeobox 6 2 2
MIRT498882 ZNF12 zinc finger protein 12 2 10
MIRT499674 NPHP3 nephrocystin 3 2 2
MIRT506932 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT509461 ZNF587 zinc finger protein 587 2 6
MIRT510048 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT514807 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT515217 CRCP CGRP receptor component 2 2
MIRT515486 INCENP inner centromere protein 2 4
MIRT517765 ZNF366 zinc finger protein 366 2 4
MIRT518216 TRMT10B tRNA methyltransferase 10B 2 2
MIRT519602 ZNF805 zinc finger protein 805 2 2
MIRT523570 GGCX gamma-glutamyl carboxylase 2 4
MIRT525795 SOD2 superoxide dismutase 2 2 2
MIRT533055 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT534218 SLC37A3 solute carrier family 37 member 3 2 4
MIRT535633 NR2E1 nuclear receptor subfamily 2 group E member 1 2 2
MIRT535863 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT536344 LEFTY1 left-right determination factor 1 2 2
MIRT537923 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT543114 SKA2 spindle and kinetochore associated complex subunit 2 2 2
MIRT544717 ZNF529 zinc finger protein 529 2 2
MIRT544847 BASP1 brain abundant membrane attached signal protein 1 2 4
MIRT545536 ARF3 ADP ribosylation factor 3 2 2
MIRT547124 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT548070 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548446 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548626 DAZAP1 DAZ associated protein 1 2 4
MIRT550259 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT551940 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552511 ZIK1 zinc finger protein interacting with K protein 1 2 4
MIRT554015 SPIRE1 spire type actin nucleation factor 1 2 2
MIRT556647 KPNA2 karyopherin subunit alpha 2 2 4
MIRT559744 ACOX1 acyl-CoA oxidase 1 2 2
MIRT560393 TMEM254 transmembrane protein 254 2 2
MIRT562234 HMGB2 high mobility group box 2 2 2
MIRT563325 ORC4 origin recognition complex subunit 4 2 2
MIRT563697 RPS26 ribosomal protein S26 2 2
MIRT565066 USP25 ubiquitin specific peptidase 25 2 2
MIRT565349 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT565624 SLC31A1 solute carrier family 31 member 1 2 2
MIRT566379 PNISR PNN interacting serine and arginine rich protein 2 2
MIRT567575 FEM1C fem-1 homolog C 2 2
MIRT569383 DDX20 DEAD-box helicase 20 2 2
MIRT570037 FAM228A family with sequence similarity 228 member A 2 2
MIRT573269 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT573912 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT620034 ST6GALNAC3 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 2 2
MIRT635606 ZWILCH zwilch kinetochore protein 2 2
MIRT644413 FRMD6 FERM domain containing 6 2 2
MIRT652528 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT656238 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT661373 DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 2 2
MIRT662530 PNPLA4 patatin like phospholipase domain containing 4 2 2
MIRT675551 MALL mal, T-cell differentiation protein like 2 2
MIRT693650 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT696348 SLC35D2 solute carrier family 35 member D2 2 2
MIRT705815 AKNA AT-hook transcription factor 2 2
MIRT707632 TARDBP TAR DNA binding protein 2 2
MIRT717902 COPS8 COP9 signalosome subunit 8 2 2
MIRT723626 SOBP sine oculis binding protein homolog 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3123 Doxorubicin 31703 NSC123127 approved sensitive High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-mir-3123 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-3123 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3123 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3123 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)

Error report submission