>HMGB2|NM_001130688|3'UTR
   1 ATGGCTATCCTTTAATGATGCGTGTGGAATGTGTGTGTGTGCTCAGGCAATTATTTTGCTAAGAATGTGAATTCAAGTGC
  81 AGCTCAATACTAGCTTCAGTATAAAAACTGTACAGATTTTTGTATAGCTGATAAGATTCTCTGTAGAGAAAATACTTTTA
 161 AAAAATGCAGGTTGTAGCTTTTTGATGGGCTACTCATACAGTTAGATTTTACAGCTTCTGATGTTGAATGTTCCTAAATA
 241 TTTAATGGTTTTTTTAATTTCTTGTGTATGGTAGCACAGCAAACTTGTAGGAATTAGTATCAATAGTAAATTTTGGGTTT
 321 TTTAGGATGTTGCATTTCGTTTTTTTAAAAAAAATTTTGTAATAAAATTATGTATATTATTTCTATTGTCTTTGTCTTAA
 401 TATGCTAAGTTAATTTTCACTTTAAAAAAGCCATTTGAAGACCAGAGCTATGTTGATTTTTTTCGGTATTTCTGCCTAGT
 481 AGTTCTTAGACACAGTTGACCTAGTAAAATGTTTGAGAATTAAAACCAAACATGCTCATATTTGCAAAATGTTCTTTAAA
 561 AGTTACATGTTGAACTCAGTGAACTTTATAAGAATTTATGCAGTTTTACAGAACGTTAAGTTTTGTACTTGACGTTTCTG
 641 TTTATTAGCTAAATTGTTCCTCAGGTGTGTGTATATATATATACATATATATATATATATATAT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucgguCGGUUGAGUGUCACGUCu 5' |: ||:||| ||||||| Target 5' agaatGTGAATTCA-AGTGCAGc 3'	62 - 83	161.00	-16.80
2	miRNA 3' ucggucgguUGAG----UGUCACGUCu 5' |||: | | ||||| Target 5' agagaaaatACTTTTAAAAAATGCAGg 3'	145 - 171	112.00	-6.70
3	miRNA 3' ucgGU-CGG-UUGAGUGUCACGUcu 5' || |:: |||| ||||| | Target 5' ttaCATGTTGAACT--CAGTGAAct 3'	563 - 585	104.00	-8.26

Mutant ID	Mutant Position	Mutant Source
COSN26979012	4	COSMIC
COSN31491687	11	COSMIC
COSN30153945	25	COSMIC
COSN31822504	30	COSMIC
COSN31562448	41	COSMIC
COSN30127400	59	COSMIC
COSN30183435	80	COSMIC
COSN31599331	107	COSMIC
COSN30473737	133	COSMIC
COSN31568128	139	COSMIC
COSN30115952	141	COSMIC
COSN30150424	146	COSMIC
COSN31604098	160	COSMIC
COSN30157120	200	COSMIC
COSN30511779	224	COSMIC
COSN26641331	233	COSMIC
COSN24294902	248	COSMIC
COSN31553045	261	COSMIC
COSN20752034	327	COSMIC
COSN21177003	347	COSMIC
COSN28409261	354	COSMIC
COSN1291815	363	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1447536031	4	dbSNP
rs372043069	6	dbSNP
rs1346064382	7	dbSNP
rs1320559712	20	dbSNP
rs200677168	21	dbSNP
rs754039888	22	dbSNP
rs777987301	27	dbSNP
rs1447041521	32	dbSNP
rs375284752	33	dbSNP
rs767584261	40	dbSNP
rs188735484	41	dbSNP
rs1313719275	42	dbSNP
rs745777808	42	dbSNP
rs750355063	42	dbSNP
rs779058613	42	dbSNP
rs1243446302	49	dbSNP
rs1413035488	50	dbSNP
rs764970086	50	dbSNP
rs1343233194	52	dbSNP
rs73005353	53	dbSNP
rs1293250721	56	dbSNP
rs1313740423	76	dbSNP
rs1009626532	82	dbSNP
rs1344976066	85	dbSNP
rs1236011672	87	dbSNP
rs202088244	88	dbSNP
rs1218209006	89	dbSNP
rs1035340626	97	dbSNP
rs1486511662	99	dbSNP
rs1002310680	108	dbSNP
rs1443873638	112	dbSNP
rs1455866741	121	dbSNP
rs111498871	122	dbSNP
rs1394739843	130	dbSNP
rs572293891	131	dbSNP
rs1161439917	133	dbSNP
rs1049310216	139	dbSNP
rs553138117	140	dbSNP
rs1287056227	141	dbSNP
rs905113226	144	dbSNP
rs1422781555	160	dbSNP
rs1441400425	160	dbSNP
rs1175339704	163	dbSNP
rs1302370171	166	dbSNP
rs184471999	168	dbSNP
rs918772015	170	dbSNP
rs930477424	171	dbSNP
rs192956285	183	dbSNP
rs1177030884	190	dbSNP
rs944276756	194	dbSNP
rs1036472338	197	dbSNP
rs1481626163	198	dbSNP
rs1212963328	201	dbSNP
rs1240887365	202	dbSNP
rs778901326	205	dbSNP
rs528200318	206	dbSNP
rs76750472	220	dbSNP
rs1252739427	230	dbSNP
rs1441251842	247	dbSNP
rs985724422	248	dbSNP
rs1160508916	250	dbSNP
rs911933213	255	dbSNP
rs1211993325	259	dbSNP
rs1400209386	264	dbSNP
rs987442709	271	dbSNP
rs372063282	273	dbSNP
rs979935447	276	dbSNP
rs1461871047	281	dbSNP
rs1353464392	283	dbSNP
rs1368506703	284	dbSNP
rs537511786	287	dbSNP
rs966729154	297	dbSNP
rs1372097405	298	dbSNP
rs932198276	309	dbSNP
rs1274474024	310	dbSNP
rs1349438945	312	dbSNP
rs1020746277	315	dbSNP
rs559017930	319	dbSNP
rs1214850681	327	dbSNP
rs568697248	338	dbSNP
rs1467423333	339	dbSNP
rs978884713	345	dbSNP
rs548746008	346	dbSNP
rs1022458660	347	dbSNP
rs1034042603	347	dbSNP
rs1175601718	347	dbSNP
rs1420092692	347	dbSNP
rs1469786081	347	dbSNP
rs887459261	348	dbSNP
rs1392126812	354	dbSNP
rs1329252210	355	dbSNP
rs1411471757	355	dbSNP
rs987940388	355	dbSNP
rs993663829	355	dbSNP
rs1314691514	356	dbSNP
rs897541636	367	dbSNP
rs1294658944	375	dbSNP
rs1435053391	376	dbSNP
rs956668086	376	dbSNP
rs1232083511	379	dbSNP
rs944224218	385	dbSNP
rs1354806679	389	dbSNP
rs1197963085	398	dbSNP
rs1274118511	403	dbSNP
rs1359679374	404	dbSNP
rs1202685259	414	dbSNP
rs1259788880	423	dbSNP
rs1034651559	453	dbSNP
rs1187248526	464	dbSNP
rs1415621944	464	dbSNP
rs891279421	465	dbSNP
rs1050448036	473	dbSNP
rs1003227564	474	dbSNP
rs1421175111	475	dbSNP
rs905080848	476	dbSNP
rs1375618848	482	dbSNP
rs1413657645	485	dbSNP
rs1408792097	491	dbSNP
rs1310504136	496	dbSNP
rs1339271781	502	dbSNP
rs1230238466	509	dbSNP
rs528825286	513	dbSNP
rs1471869157	522	dbSNP
rs542451194	527	dbSNP
rs1226569622	534	dbSNP
rs1282764090	541	dbSNP
rs932888464	546	dbSNP
rs994655562	558	dbSNP
rs925282235	559	dbSNP
rs189039046	566	dbSNP
rs1193807028	576	dbSNP
rs75136761	578	dbSNP
rs914021035	580	dbSNP
rs563267252	588	dbSNP
rs890540644	589	dbSNP
rs1433686221	590	dbSNP
rs1171260508	591	dbSNP
rs1051694396	609	dbSNP
rs1384493900	614	dbSNP
rs1319704700	619	dbSNP
rs1324225619	622	dbSNP
rs1433866287	626	dbSNP
rs1318402248	628	dbSNP
rs1033495615	633	dbSNP
rs552550001	634	dbSNP
rs1227210645	640	dbSNP
rs981109318	653	dbSNP
rs932011565	654	dbSNP
rs951963455	659	dbSNP
rs531992654	662	dbSNP
rs979019988	664	dbSNP
rs868645089	666	dbSNP
rs913365631	667	dbSNP
rs1008625976	669	dbSNP
rs1452895247	671	dbSNP
rs1364798194	673	dbSNP
rs562910750	673	dbSNP
rs1049885773	674	dbSNP
rs1382093470	678	dbSNP
rs1286960666	680	dbSNP
rs895073301	682	dbSNP
rs1372730000	683	dbSNP
rs1300315396	684	dbSNP
rs1438341938	684	dbSNP
rs561019112	684	dbSNP
rs866711569	684	dbSNP
rs33987506	685	dbSNP
rs981760933	685	dbSNP
rs1178414280	686	dbSNP
rs1491225134	686	dbSNP
rs6853427	686	dbSNP
rs1233889162	687	dbSNP
rs1194442306	688	dbSNP
rs1295184139	688	dbSNP
rs1332822914	688	dbSNP
rs529720430	688	dbSNP
rs113797143	690	dbSNP
rs1486277116	690	dbSNP
rs1419348993	691	dbSNP
rs904144046	691	dbSNP
rs1373300296	692	dbSNP
rs1421572795	692	dbSNP
rs1305945283	693	dbSNP
rs963635105	693	dbSNP
rs1309479473	694	dbSNP
rs1314691600	694	dbSNP
rs1415294054	694	dbSNP
rs1014723575	695	dbSNP
rs72062446	695	dbSNP
rs1044361035	696	dbSNP
rs1349097593	696	dbSNP
rs1213592359	697	dbSNP
rs1180773200	698	dbSNP
rs1256047278	698	dbSNP
rs1429907808	699	dbSNP
rs945407125	699	dbSNP
rs1005143584	700	dbSNP
rs1420120210	701	dbSNP
rs1175375477	702	dbSNP
rs1189258615	702	dbSNP
rs913886911	702	dbSNP
rs1380712097	703	dbSNP
rs866745630	703	dbSNP
rs1051818949	704	dbSNP
rs1491216260	704	dbSNP
rs10632983	705	dbSNP
rs1186229914	705	dbSNP
rs1195262628	705	dbSNP
rs1217198073	705	dbSNP
rs1247047719	705	dbSNP
rs1260774802	705	dbSNP
rs1312115233	705	dbSNP
rs1454502112	705	dbSNP
rs1486581235	705	dbSNP
rs1491439817	705	dbSNP
rs201378789	705	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.