miRTarBase - #MIRT475801


—
pre-miRNA Information
pre-miRNA hsa-mir-6737   
Genomic Coordinates chr1: 153962351 - 153962420
Description Homo sapiens miR-6737 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6737-5p
Sequence 6| UUGGGGUGGUCGGCCCUGGAG |26
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs766338599 4 dbSNP
rs765728788 7 dbSNP
rs757341439 9 dbSNP
rs539511149 11 dbSNP
rs764259486 12 dbSNP
rs988937601 21 dbSNP
Putative Targets

Gene Information
Gene Symbol HDGF   
Synonyms HMG1L2
Description heparin binding growth factor
Transcript NM_001126050   
Other Transcripts NM_001126051 , NM_004494   
Expression
Putative miRNA Targets on HDGF
3'UTR of HDGF
(miRNA target sites are highlighted)		 
>HDGF|NM_001126050|3'UTR
   1 CCACCAATGTTTCAAGAGGAGCCCCCACCCTGTTCCTGCTGCTGTCTGGGTGCTACTGGGGAAACTGGCCATGGCCTGCA
  81 AACTGGGAACCCCTTTCCCACCCCAACCTGCTCTCCTCTTCTACTCACTTTTCCCACTCCAAGCCCAGCCCATGGAGATT
 161 GACCTGGATGGGGCAGGCCACCTGGCTCTCACCTCTAGGTCCCCATACTCCTATGATCTGAGTCAGAGCCATGTCTTCTC
 241 CCTGGAATGAGTTGAGGCCACTGTGTTCCTTCCGCTTGGAGCTATTTTCCAGGCTTCTGCTGGGGCCTGGGACAACTGCT
 321 CCCACCTCCTGACACCCTTCTCCCACTCTCCTAGGCATTCTGGACCTCTGGGTTGGGATCAGGGGTAGGAATGGAAAGGA
 401 TGGAGCATCAACAGCAGGGTGGGCTTGTGGGGCCTGGGAGGGGCAATCCTCAAATGCGGGGTGGGGGCAGCACAGGAGGG
 481 CGGCCTCCTTCTGAGCTCCTGTCCCCTGCTACACCTATTATCCCAGCTGCCTAGATTCAGGGAAAGTGGGACAGCTTGTA
 561 GGGGAGGGGCTCCTTTCCATAAATCCTTGATGATTGACAACACCCATTTTTCCTTTTGCCGACCCCAAGAGTTTTGGGAG
 641 TTGTAGTTAATCATCAAGAGAATTTGGGGCTTCCAAGTTGTTCGGGCCAAGGACCTGAGACCTGAAGGGTTGACTTTACC
 721 CATTTGGGTGGGAGTGTTGAGCATCTGTCCCCCTTTAGATCTCTGAAGCCACAAATAGGATGCTTGGGAAGACTCCTAGC
 801 TGTCCTTTTTCCTCTCCACACAGTGCTCAAGGCCAGCTTATAGTCATATATATCACCCAGACATAAAGGAAAAGACACAT
 881 TTTTTAGGAAATGTTTTTAATAAAAGAAAATTACAAAAAAAAATTTTAAAGACCCCTAACCCTTTGTGTGCTCTCCATTC
 961 TGCTCCTTCCCCATCGTTGCCCCCATTTCTGAGGTGCACTGGGAGGCTCCCCTTCTATTTGGGGCTTGATGACTTTCTTT
1041 TTGTAGCTGGGGCTTTGATGTTCCTTCCAGTGTCATTTCTCATCCACATACCCTGACCTGGCCCCCTCAGTGTTGTCACC
1121 AGATCTGATTTGTAACCCACTGAGAGGACAGAGAGAAATAAGTGCCCTCTCCCACCCTCTTCCTACTGGTCTCTCTATGC
1201 CTCTCTACAGTCTCGTCTCTTTTACCCTGGCCCCTCTCCCTTGGGCTCTGATGAAAAATTGCTGACTGTAGCTTTGGAAG
1281 TTTAGCTCTGAGAACCGTAGATGATTTCAGTTCTAGGAAAATAAAACCCGTTGATTACTATAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaggucccggcuGGUGGGGUu 5'
                      |||||||| 
Target 5' ggaacccctttcCCACCCCAa 3'
 86 - 106 145.00 -17.30
2 
miRNA  3' gaggucccggcuGGUGGGGUu 5'
                      ||||:||| 
Target 5' tactcacttttcCCACTCCAa 3'
 122 - 142 129.00 -15.80
3 
miRNA  3' gaggUCC-CGGCUGGUGGGGUu 5'
              ||| |||  ||||||:: 
Target 5' caagAGGAGCC-CCCACCCTGt 3'
 13 - 33 124.00 -18.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30515293 7 COSMIC
COSN20048132 13 COSMIC
COSN30522638 17 COSMIC
COSN31497739 19 COSMIC
COSN26957679 27 COSMIC
COSN28846451 46 COSMIC
COSN31560070 52 COSMIC
COSN30504382 53 COSMIC
COSN20048131 56 COSMIC
COSN30515830 74 COSMIC
COSN31498013 86 COSMIC
COSN20048130 97 COSMIC
COSN20048129 102 COSMIC
COSN30698706 129 COSMIC
COSN30448034 133 COSMIC
COSN20048128 145 COSMIC
COSN20048127 151 COSMIC
COSN32064393 190 COSMIC
COSN1090220 221 COSMIC
COSN30513454 223 COSMIC
COSN20048126 240 COSMIC
COSN19751296 274 COSMIC
COSN31604573 275 COSMIC
COSN31590958 279 COSMIC
COSN20048125 297 COSMIC
COSN20048124 319 COSMIC
COSN20048122 340 COSMIC
COSN20048121 366 COSMIC
COSN21181678 368 COSMIC
COSN20048120 471 COSMIC
COSN16131710 481 COSMIC
COSN21077464 490 COSMIC
COSN20048119 491 COSMIC
COSN30655904 494 COSMIC
COSN22708405 592 COSMIC
COSN31608710 616 COSMIC
COSN20052292 629 COSMIC
COSN31564827 683 COSMIC
COSN16128463 699 COSMIC
COSN32063501 727 COSMIC
COSN26660939 825 COSMIC
COSN4744091 849 COSMIC
COSN30161775 873 COSMIC
COSN31661798 880 COSMIC
COSN20095450 914 COSMIC
COSN31523184 985 COSMIC
COSN31548360 989 COSMIC
COSN31589224 997 COSMIC
COSN1407568 1048 COSMIC
COSN22445060 1127 COSMIC
COSN21373532 1227 COSMIC
COSN26554725 1295 COSMIC
COSN32082890 1317 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765803425 2 dbSNP
rs1489004484 5 dbSNP
rs11556973 7 dbSNP
rs896281935 8 dbSNP
rs753925386 23 dbSNP
rs764091839 28 dbSNP
rs1014697471 29 dbSNP
rs1477272522 32 dbSNP
rs1259311323 36 dbSNP
rs1416492412 37 dbSNP
rs760950183 40 dbSNP
rs1488527601 41 dbSNP
rs1266474668 44 dbSNP
rs1005001875 51 dbSNP
rs566825660 75 dbSNP
rs1369246614 107 dbSNP
rs887454019 117 dbSNP
rs1452704416 120 dbSNP
rs1288547436 121 dbSNP
rs1338648843 123 dbSNP
rs1278963223 126 dbSNP
rs1402057938 126 dbSNP
rs1048709381 140 dbSNP
rs1227165592 147 dbSNP
rs761518823 152 dbSNP
rs144243169 159 dbSNP
rs1215468134 174 dbSNP
rs1354550131 179 dbSNP
rs1283466787 180 dbSNP
rs11556977 184 dbSNP
rs1468654460 187 dbSNP
rs1406039162 188 dbSNP
rs1040328912 191 dbSNP
rs1183536376 193 dbSNP
rs1414395122 195 dbSNP
rs1481653579 202 dbSNP
rs1418309598 205 dbSNP
rs1362189770 213 dbSNP
rs1406048282 220 dbSNP
rs1421826051 223 dbSNP
rs539607564 224 dbSNP
rs1176905460 229 dbSNP
rs568589896 234 dbSNP
rs550698416 238 dbSNP
rs532200506 240 dbSNP
rs935406720 243 dbSNP
rs1223694313 244 dbSNP
rs768366521 251 dbSNP
rs1262475228 267 dbSNP
rs1240493756 269 dbSNP
rs979409695 271 dbSNP
rs781196137 273 dbSNP
rs749563787 274 dbSNP
rs1359019118 276 dbSNP
rs992464618 277 dbSNP
rs1176696925 292 dbSNP
rs565052677 293 dbSNP
rs1382003508 297 dbSNP
rs1440015704 311 dbSNP
rs1159480053 321 dbSNP
rs540058701 329 dbSNP
rs116207813 332 dbSNP
rs1412856058 348 dbSNP
rs1336298303 351 dbSNP
rs1359780705 356 dbSNP
rs1015139286 358 dbSNP
rs1373635234 360 dbSNP
rs1004673046 366 dbSNP
rs369723450 368 dbSNP
rs866153960 370 dbSNP
rs577504203 371 dbSNP
rs1241240938 386 dbSNP
rs1273904177 387 dbSNP
rs1027303633 399 dbSNP
rs561181123 401 dbSNP
rs1382671187 408 dbSNP
rs1278798632 417 dbSNP
rs1306402252 423 dbSNP
rs995809224 425 dbSNP
rs1338028707 436 dbSNP
rs900153718 456 dbSNP
rs1411982740 457 dbSNP
rs1039957984 458 dbSNP
rs1477185295 460 dbSNP
rs1174528316 461 dbSNP
rs73002713 468 dbSNP
rs1465113483 481 dbSNP
rs574912091 481 dbSNP
rs1401449631 482 dbSNP
rs1329710018 490 dbSNP
rs556376794 490 dbSNP
rs534268126 495 dbSNP
rs1275016711 498 dbSNP
rs1339282012 501 dbSNP
rs1259939914 503 dbSNP
rs1181796469 505 dbSNP
rs1212956130 506 dbSNP
rs1287549090 508 dbSNP
rs1444136774 510 dbSNP
rs1188367772 512 dbSNP
rs544732053 515 dbSNP
rs577276057 517 dbSNP
rs550444571 518 dbSNP
rs1242438081 529 dbSNP
rs1247438982 537 dbSNP
rs1184056621 540 dbSNP
rs199960326 552 dbSNP
rs1425833744 565 dbSNP
rs781239733 576 dbSNP
rs1466667792 582 dbSNP
rs1163178943 597 dbSNP
rs1258686000 607 dbSNP
rs925345802 616 dbSNP
rs757395551 620 dbSNP
rs1339389645 621 dbSNP
rs1397722094 634 dbSNP
rs1279586293 641 dbSNP
rs1340591445 646 dbSNP
rs1244044001 650 dbSNP
rs1282293146 652 dbSNP
rs1243392157 655 dbSNP
rs1287783718 656 dbSNP
rs35554110 661 dbSNP
rs751664551 666 dbSNP
rs1285020601 674 dbSNP
rs1488110706 675 dbSNP
rs777801928 676 dbSNP
rs377077660 683 dbSNP
rs1367196537 684 dbSNP
rs916531893 686 dbSNP
rs1315140795 688 dbSNP
rs1360252195 691 dbSNP
rs1398242978 710 dbSNP
rs1360513948 711 dbSNP
rs1299636854 714 dbSNP
rs992099180 717 dbSNP
rs960902850 729 dbSNP
rs907722145 732 dbSNP
rs1342139111 743 dbSNP
rs11556978 744 dbSNP
rs1308350481 747 dbSNP
rs1431980467 751 dbSNP
rs1351220444 762 dbSNP
rs1238269932 770 dbSNP
rs1288345556 789 dbSNP
rs1486253605 796 dbSNP
rs1199896242 802 dbSNP
rs1254141313 804 dbSNP
rs1444673071 819 dbSNP
rs1380137482 826 dbSNP
rs1438153311 827 dbSNP
rs1362667180 832 dbSNP
rs1380484651 835 dbSNP
rs138665143 836 dbSNP
rs1465125772 841 dbSNP
rs1300612693 845 dbSNP
rs758670127 847 dbSNP
rs1403719359 848 dbSNP
rs1396598659 856 dbSNP
rs1330530682 886 dbSNP
rs951851794 891 dbSNP
rs1161963660 892 dbSNP
rs548570568 900 dbSNP
rs1311770440 903 dbSNP
rs1424091745 906 dbSNP
rs1027376790 910 dbSNP
rs1385881587 911 dbSNP
rs1165575683 912 dbSNP
rs1238029198 914 dbSNP
rs1425444752 916 dbSNP
rs1259623497 922 dbSNP
rs1185695726 923 dbSNP
rs1207135523 924 dbSNP
rs1251657014 924 dbSNP
rs201760421 924 dbSNP
rs60294423 924 dbSNP
rs1173506409 926 dbSNP
rs1378879017 928 dbSNP
rs1486107478 930 dbSNP
rs995841930 934 dbSNP
rs1467101650 940 dbSNP
rs1331839874 941 dbSNP
rs566809290 942 dbSNP
rs1386479705 948 dbSNP
rs1358299414 962 dbSNP
rs1291805034 971 dbSNP
rs1224153128 973 dbSNP
rs554872714 1001 dbSNP
rs1019018275 1009 dbSNP
rs1258000233 1012 dbSNP
rs1008519908 1017 dbSNP
rs1201071443 1023 dbSNP
rs777212858 1028 dbSNP
rs891354493 1032 dbSNP
rs7801 1037 dbSNP
rs9842 1038 dbSNP
rs1306234336 1039 dbSNP
rs1189107766 1041 dbSNP
rs1268972628 1044 dbSNP
rs1480491399 1048 dbSNP
rs1192363500 1049 dbSNP
rs999707875 1060 dbSNP
rs1215509273 1063 dbSNP
rs1467179358 1065 dbSNP
rs1171041862 1067 dbSNP
rs1342849486 1073 dbSNP
rs753587756 1088 dbSNP
rs1292030481 1091 dbSNP
rs1301696272 1105 dbSNP
rs1405753477 1119 dbSNP
rs1277689126 1121 dbSNP
rs904000907 1127 dbSNP
rs568877526 1130 dbSNP
rs144777532 1134 dbSNP
rs189681903 1137 dbSNP
rs1219762679 1138 dbSNP
rs756107317 1143 dbSNP
rs1267584004 1147 dbSNP
rs1490423527 1151 dbSNP
rs916622866 1155 dbSNP
rs1260485529 1175 dbSNP
rs865806287 1176 dbSNP
rs1187042413 1186 dbSNP
rs1412922633 1194 dbSNP
rs142515861 1195 dbSNP
rs1166714308 1197 dbSNP
rs1803706 1199 dbSNP
rs1385597802 1201 dbSNP
rs1425601590 1202 dbSNP
rs1297760650 1203 dbSNP
rs546738586 1205 dbSNP
rs528327523 1206 dbSNP
rs1401878930 1207 dbSNP
rs1289995712 1208 dbSNP
rs1379147373 1213 dbSNP
rs561142350 1214 dbSNP
rs1227076417 1215 dbSNP
rs1360598124 1217 dbSNP
rs907795514 1224 dbSNP
rs1489000231 1226 dbSNP
rs767562522 1233 dbSNP
rs1236361294 1249 dbSNP
rs951884003 1260 dbSNP
rs1183520620 1268 dbSNP
rs1243545068 1270 dbSNP
rs920393890 1272 dbSNP
rs1803707 1277 dbSNP
rs974497936 1283 dbSNP
rs1425426507 1284 dbSNP
rs1159979251 1285 dbSNP
rs964427211 1286 dbSNP
rs372144755 1296 dbSNP
rs1008967329 1303 dbSNP
rs1490071715 1315 dbSNP
rs1306660319 1316 dbSNP
rs1355468541 1318 dbSNP
rs761167868 1320 dbSNP
rs955705784 1330 dbSNP
rs113461500 1331 dbSNP
rs1309876460 1334 dbSNP
rs369139530 1338 dbSNP
rs1212157746 1340 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaggucccggcuGGUGGGGUu 5'
                      |||||||| 
Target 5' --aaccccuuucCCACCCCAa 3'
 		1 - 19
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaggucccggcuGGUGGGGUu 5'
                      |||||||| 
Target 5' --------uuucCCACCCCAa 3'
 		1 - 13
Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000357325.5 | 3UTR | AACCCCUUUCCCACCCCAACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
67 hsa-miR-6737-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066215 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT074413 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT125300 MID1IP1 MID1 interacting protein 1 2 2
MIRT153951 NCOA3 nuclear receptor coactivator 3 2 2
MIRT452776 FAM136A family with sequence similarity 136 member A 2 2
MIRT452977 CABP4 calcium binding protein 4 2 2
MIRT454128 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT455242 DDX39B DExD-box helicase 39B 2 10
MIRT459007 UQCRH ubiquinol-cytochrome c reductase hinge protein 2 2
MIRT459463 MUC17 mucin 17, cell surface associated 2 4
MIRT460871 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461264 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT464540 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT465268 TRIM28 tripartite motif containing 28 2 2
MIRT465871 TMEM43 transmembrane protein 43 2 4
MIRT466228 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT468417 SETD1B SET domain containing 1B 2 2
MIRT468684 SEC22C SEC22 homolog C, vesicle trafficking protein 2 4
MIRT473399 MDM4 MDM4, p53 regulator 2 2
MIRT473517 MAX MYC associated factor X 2 2
MIRT474511 KLHDC8A kelch domain containing 8A 2 2
MIRT475801 HDGF heparin binding growth factor 2 2
MIRT479493 CDH6 cadherin 6 2 2
MIRT480770 BMP2 bone morphogenetic protein 2 2 2
MIRT481418 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT482966 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT483380 SPATA6 spermatogenesis associated 6 2 4
MIRT483677 CYP11A1 cytochrome P450 family 11 subfamily A member 1 2 2
MIRT484328 EPN1 epsin 1 2 4
MIRT484963 UCK1 uridine-cytidine kinase 1 2 2
MIRT485908 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT488149 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488943 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 6
MIRT491835 ZBTB7A zinc finger and BTB domain containing 7A 2 4
MIRT493026 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT499374 PLCG2 phospholipase C gamma 2 2 11
MIRT499723 USH1G USH1 protein network component sans 2 4
MIRT500349 ZNF385A zinc finger protein 385A 2 2
MIRT509574 HIST2H2AB histone cluster 2 H2A family member b 2 4
MIRT512794 GLRX glutaredoxin 2 2
MIRT513291 SETBP1 SET binding protein 1 2 2
MIRT515697 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT518255 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT522026 PAQR3 progestin and adipoQ receptor family member 3 2 4
MIRT523169 HIST3H3 histone cluster 3 H3 2 2
MIRT524036 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT533476 TRIM71 tripartite motif containing 71 2 2
MIRT541488 ADM adrenomedullin 2 2
MIRT553987 SRPR SRP receptor alpha subunit 2 2
MIRT571445 YKT6 YKT6 v-SNARE homolog 2 2
MIRT574889 Plcg2 phospholipase C, gamma 2 2 7
MIRT607544 GLI2 GLI family zinc finger 2 2 2
MIRT607688 MAPK10 mitogen-activated protein kinase 10 2 2
MIRT610072 CRLF1 cytokine receptor like factor 1 2 2
MIRT610573 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT614041 THBS2 thrombospondin 2 2 2
MIRT626318 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT634005 RIF1 replication timing regulatory factor 1 2 2
MIRT639619 FGF19 fibroblast growth factor 19 2 2
MIRT647343 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT689704 ATXN2 ataxin 2 2 2
MIRT691170 APOL6 apolipoprotein L6 2 2
MIRT693165 NPR1 natriuretic peptide receptor 1 2 2
MIRT711727 NUPL2 nucleoporin like 2 2 2
MIRT711806 ELN elastin 2 2
MIRT721546 FXN frataxin 2 2
MIRT722979 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6737 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-6737 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-6737-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-6737-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-6737-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6737-5p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission