| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-3136 |
| Genomic Coordinates | chr3: 69048958 - 69049035 |
| Description | Homo sapiens miR-3136 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-3136-5p | ||||||||||||
| Sequence | 10| CUGACUGAAUAGGUAGGGUCAUU |32 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Illumina | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | GOLGA8A | ||||||||||||||||||||
| Synonyms | GM88 | ||||||||||||||||||||
| Description | golgin A8 family member A | ||||||||||||||||||||
| Transcript | NM_181077 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on GOLGA8A | |||||||||||||||||||||
| 3'UTR of GOLGA8A (miRNA target sites are highlighted) |
>GOLGA8A|NM_181077|3'UTR 1 ACACCACCATCATCAAAGAGCTGCTCAAGAAATTTTTAAAAACGAAACAAAGTTATGGGGTTAATCTCCTACACAATTCA 81 TTTACTTCATTTGAATGTTAGAGCTACTCATGATTATTTGTGTTTCTAATTTATAGTTTAAGTTTATTTGTAAAAAGTTA 161 AAAGAGAGTGGGTCTCTGTGGCTCTCACTGATGTTCACTCTGGCATCCTTCAGCATTTTTCTTTTTTCATTTCATAATTG 241 TAGGTCATTAGCATGCATATCGAGTTTGCCCTTACGTGGTGGGAGTTCAAACACACAAAGACCCACTCTTTGCACAAAAC 321 TGTTCTCGCTGGTTTGGAATAGGCTCCCGTGCTTTTCTAATGTTATTGCAGCATGGATGTCCATTACAGAATTCAGATAA 401 AATTTGCTAATGTTCTGCTATGATGTTTGATCTCATCTTAATCACAGTGAGCTCTTCTATAGCTCAATATGCGGTTTGCC 481 CTCAAGTGTGCACTGTTTATTACTTTGTAATATGCCACTGTGAGTACTGACATTTAGAGCTGTTTAAAGGCCGAGAACTG 561 GAAACAGCCTTTCCTCCATTTTCTGTGTATTGGTGATGGGAGTGATAACCTTTTGGGGGAGCTTTCTAAATCTCACAGAA 641 GAGGAAAGTGGCCTGCTCTGGCAGGTATGTGCAGGATACAGTGTGTTTCATCTGTTCCGGTGCCAAGAATGAGCAGTGTA 721 CTGTGGCAGTTCCCTTTGGATTTGTATGTGCTCTGGGCTCATGAAGATATTGCATCGTGAGCTGCAGCAGTTGCACTCTT 801 TTTCAGTGACCTAAAAAGGGCTTATTTCCGAGGAATGAAAGGCTGCCATCATTGGCTGTGGGTGTGAAAAACCTTTCCTA 881 GCTTAGAGCATTTGTATCTACAATACATTTTAAAGTCAGAGTTCGTGTTCCCTGTTTTAATCACATGACTACCTGTCCCA 961 GTACACGAAAGGGCGCTGGTTGGCATTCTTCTTAATGTATTTAGTGAAGATCATAAGAAATCCTTTAAGAGTTTAAATGT 1041 CTCTGAAACAGGCATACAGGCTCTAGTCAAGAATGAATTAGAGTGAAGGAAAGCTGTGTGACACCTGGCATTCCTCTCTG 1121 TTCATGGAGCTTCTTTGAGGCTTGAAGTTTGATTTTACTATCTAGACCTCTCTGGCTAATACCTATTCTTCAACCACCTC 1201 GGTTACTCTGACATAGGAATTTACTTCTTTTCCTTGAGTGGAAAACACTTTAGAAAGTAATAACAAACATTATTATAAAC 1281 TAATATATGTGAGAGTACTTAGTTGAAACAAAAAGGAATTTTAGTAGACAGTATTATATTATCTTTGAAAATCAAGGAGA 1361 AGTTTATGCAACTTAAAATGTTTACACACTGTGGTGCAATCTACTGTTTGTGAATGTCTGTATTATCAGGAAACATGTCT 1441 ATACGATCGCAGAGTTGTATTTCCTCACAAACTTCTTTACGAAGAGTGAAATACGTTTTTGTACCTCTCATTTTCAGTCA 1521 GGGACATACTTTGTGCAATATTTCTGTGATTGTGCCTATGCATGATGAATGAATGCATTTCAATCATACATTGCCTAAAT 1601 CATAACTTGATGATGCTTGGGAAAGAATCAACAGTTAAAACTTCATGAAGTTCTAATGTCTGTGTTCCAAAACACATCAC 1681 ATTATTAGGTTGTAGGGAGATATGTAGGTGTGCTCCCTGGGGTGGGGAGTTTTCTAGTTACTAGACCATCTCCATTTTTA 1761 GCACTTGGCAGCCTCATGATCCTTTTATAAATGTGAGATTAACAGGAGAGCAGCAATACGATTTTGCCAATGGAATAACA 1841 GATTTGCCGGCATTCACTGAAAGAGGGCAGATATTGGGTCCTTGTAACTTCAACTGACTCTTCCAAATTGTATGAATTTA 1921 TCAATGTATTACACAAATCCAGTTTCAGAATGATAAAAAATGTTAGACCAAATAATGCGGCTAATTAACAGTCGTATGAT 2001 TTCTAGCCCATGGGTTTAAAACTGTATCTTAAAGAGTCATTTTAAAATAATATAAATATTAAAAAATGTAACTGCTATCT 2081 TAATGTTCTGAAATAAAACATTTTAAAATATAAATCCTGTAGTTTAAAAGGAAGAAATGGTGGGAAGGAAAAGTAGAGAA 2161 AGAAATGCCAATTCCAGGCCAAAGCGTTATTTGCCAAGTTTTCTTAGAATGAATTTTACCAATGTATGAGTTCTTGTTAA 2241 CAGAATGTGTAACGGAAATACTGAAAGACTTTTGCTTAAAGTGGCATTATTGACTGCTGATGTGATGCTACTGTAATGCA 2321 ATAAATTTTTAAATTGTTGCAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 23015.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000360553.3 | 3UTR | UCAGGGACAUACUUUGUGCAAUAUUUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000360553.3 | 3UTR | UCAGGGACAUACUUUGUGCAAUAUUUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000360553.3 | 3UTR | UUUCAGUCAGGGACAUACUUUGUGCAAUAUUUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000360553.3 | 3UTR | UCAGGGACAUACUUUGUGCAAUAUUUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000360553.3 | 3UTR | UCAGGGACAUACUUUGUGCAAUAUUUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000360553.3 | 3UTR | UCAGGGACAUACUUUGUGCAAUAUUUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000360553.3 | 3UTR | UACCUCUCAUUUUCAGUCAGGGACAUACUUUGUGCAAUAUUUCUGUGAUUGUGCCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
84 hsa-miR-3136-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT081899 | KCTD15 | potassium channel tetramerization domain containing 15 |  |
|
2 | 2 | ||||||
| MIRT185493 | SRP9 | signal recognition particle 9 | |
|
2 | 2 | ||||||
| MIRT207226 | TET3 | tet methylcytosine dioxygenase 3 | |
|
2 | 2 | ||||||
| MIRT246179 | TXNIP | thioredoxin interacting protein | |
|
2 | 4 | ||||||
| MIRT347685 | LSM14A | LSM14A, mRNA processing body assembly factor | |
|
2 | 2 | ||||||
| MIRT444157 | ZNF701 | zinc finger protein 701 | |
|
2 | 2 | ||||||
| MIRT444505 | ZNF525 | zinc finger protein 525 | |
|
2 | 2 | ||||||
| MIRT444683 | NDOR1 | NADPH dependent diflavin oxidoreductase 1 | |
|
2 | 2 | ||||||
| MIRT445131 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | |
|
2 | 2 | ||||||
| MIRT446184 | FGF1 | fibroblast growth factor 1 | |
|
2 | 2 | ||||||
| MIRT447946 | AKR7A2 | aldo-keto reductase family 7 member A2 | |
|
2 | 2 | ||||||
| MIRT449366 | ANTXR2 | anthrax toxin receptor 2 | |
|
2 | 2 | ||||||
| MIRT449774 | SULF2 | sulfatase 2 | |
|
2 | 2 | ||||||
| MIRT450096 | ST8SIA5 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT450903 | CADM2 | cell adhesion molecule 2 | |
|
2 | 4 | ||||||
| MIRT455645 | YARS | tyrosyl-tRNA synthetase | |
|
2 | 2 | ||||||
| MIRT465135 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT476177 | GOLGA8A | golgin A8 family member A | |
|
2 | 8 | ||||||
| MIRT483978 | PANK1 | pantothenate kinase 1 | |
|
2 | 10 | ||||||
| MIRT497016 | INO80B | INO80 complex subunit B | |
|
2 | 2 | ||||||
| MIRT497450 | DDR2 | discoidin domain receptor tyrosine kinase 2 | |
|
2 | 2 | ||||||
| MIRT497626 | ZNF576 | zinc finger protein 576 | |
|
2 | 2 | ||||||
| MIRT498187 | AKR1B10 | aldo-keto reductase family 1 member B10 | |
|
2 | 2 | ||||||
| MIRT504036 | TOMM5 | translocase of outer mitochondrial membrane 5 | |
|
2 | 2 | ||||||
| MIRT507106 | GOLGA8B | golgin A8 family member B | |
|
2 | 4 | ||||||
| MIRT507900 | CALM2 | calmodulin 2 | |
|
2 | 6 | ||||||
| MIRT508802 | MTPN | myotrophin | |
|
2 | 6 | ||||||
| MIRT510407 | ZNF268 | zinc finger protein 268 | |
|
2 | 4 | ||||||
| MIRT516297 | F8A2 | coagulation factor VIII associated 2 | |
|
2 | 2 | ||||||
| MIRT516323 | F8A3 | coagulation factor VIII associated 3 | |
|
2 | 2 | ||||||
| MIRT528028 | FEZ2 | fasciculation and elongation protein zeta 2 | |
|
2 | 2 | ||||||
| MIRT529396 | ICK | intestinal cell kinase | |
|
2 | 2 | ||||||
| MIRT534463 | SCD | stearoyl-CoA desaturase | |
|
2 | 4 | ||||||
| MIRT535438 | PDE4D | phosphodiesterase 4D | |
|
2 | 2 | ||||||
| MIRT538187 | DBN1 | drebrin 1 | |
|
2 | 2 | ||||||
| MIRT547386 | MOB1A | MOB kinase activator 1A | |
|
2 | 2 | ||||||
| MIRT548180 | FOXC1 | forkhead box C1 | |
|
2 | 2 | ||||||
| MIRT561585 | SKI | SKI proto-oncogene | |
|
2 | 2 | ||||||
| MIRT569449 | PIGP | phosphatidylinositol glycan anchor biosynthesis class P | |
|
2 | 2 | ||||||
| MIRT573314 | RFC5 | replication factor C subunit 5 | |
|
2 | 2 | ||||||
| MIRT574762 | FLVCR1 | feline leukemia virus subgroup C cellular receptor 1 | |
|
2 | 2 | ||||||
| MIRT575975 | Fem1a | feminization 1 homolog a (C. elegans) | |
|
2 | 5 | ||||||
| MIRT575999 | Zfp106 | zinc finger protein 106 | |
1 | 1 | |||||||
| MIRT576277 | Cd59a | CD59a antigen | |
1 | 1 | |||||||
| MIRT606772 | KIAA0040 | KIAA0040 | |
|
2 | 5 | ||||||
| MIRT606833 | FEM1A | fem-1 homolog A | |
|
2 | 7 | ||||||
| MIRT608302 | MCM8 | minichromosome maintenance 8 homologous recombination repair factor | |
|
2 | 2 | ||||||
| MIRT609269 | MAPKAPK5 | mitogen-activated protein kinase-activated protein kinase 5 | |
|
2 | 2 | ||||||
| MIRT609405 | SLC25A45 | solute carrier family 25 member 45 | |
|
2 | 2 | ||||||
| MIRT609603 | TRPC4AP | transient receptor potential cation channel subfamily C member 4 associated protein | |
|
2 | 2 | ||||||
| MIRT610105 | IL17REL | interleukin 17 receptor E like | |
|
2 | 3 | ||||||
| MIRT610327 | SSX5 | SSX family member 5 | |
|
2 | 2 | ||||||
| MIRT610610 | ARHGAP18 | Rho GTPase activating protein 18 | |
|
2 | 2 | ||||||
| MIRT611066 | ZNF621 | zinc finger protein 621 | |
|
2 | 2 | ||||||
| MIRT611492 | ZNF440 | zinc finger protein 440 | |
|
2 | 2 | ||||||
| MIRT611931 | ZNF106 | zinc finger protein 106 | |
|
2 | 3 | ||||||
| MIRT612239 | MICALL1 | MICAL like 1 | |
|
2 | 2 | ||||||
| MIRT612451 | SMOC1 | SPARC related modular calcium binding 1 | |
|
2 | 4 | ||||||
| MIRT612567 | RBBP5 | RB binding protein 5, histone lysine methyltransferase complex subunit | |
|
2 | 2 | ||||||
| MIRT613111 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | |
|
2 | 2 | ||||||
| MIRT614946 | KAT6B | lysine acetyltransferase 6B | |
|
2 | 2 | ||||||
| MIRT615100 | BNC2 | basonuclin 2 | |
|
2 | 2 | ||||||
| MIRT616424 | FAM126B | family with sequence similarity 126 member B | |
|
2 | 2 | ||||||
| MIRT617839 | FMO4 | flavin containing monooxygenase 4 | |
|
2 | 2 | ||||||
| MIRT618499 | HSPD1 | heat shock protein family D (Hsp60) member 1 | |
|
2 | 2 | ||||||
| MIRT619230 | FBXL4 | F-box and leucine rich repeat protein 4 | |
|
2 | 2 | ||||||
| MIRT624202 | DCP2 | decapping mRNA 2 | |
|
2 | 4 | ||||||
| MIRT630405 | MTX3 | metaxin 3 | |
|
2 | 2 | ||||||
| MIRT640327 | DAAM2 | dishevelled associated activator of morphogenesis 2 | |
|
2 | 2 | ||||||
| MIRT642779 | CHCHD3 | coiled-coil-helix-coiled-coil-helix domain containing 3 | |
|
2 | 2 | ||||||
| MIRT654363 | RBM23 | RNA binding motif protein 23 | |
|
2 | 2 | ||||||
| MIRT654482 | RANBP2 | RAN binding protein 2 | |
|
2 | 2 | ||||||
| MIRT656336 | MED28 | mediator complex subunit 28 | |
|
2 | 2 | ||||||
| MIRT662856 | UPF3A | UPF3A, regulator of nonsense mediated mRNA decay | |
|
2 | 2 | ||||||
| MIRT666894 | POLA2 | DNA polymerase alpha 2, accessory subunit | |
|
2 | 2 | ||||||
| MIRT669526 | AP5M1 | adaptor related protein complex 5 mu 1 subunit | |
|
2 | 2 | ||||||
| MIRT671561 | IL2RA | interleukin 2 receptor subunit alpha | |
|
2 | 2 | ||||||
| MIRT707042 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | |
|
2 | 2 | ||||||
| MIRT717063 | MTMR6 | myotubularin related protein 6 | |
|
2 | 2 | ||||||
| MIRT717223 | SH2D5 | SH2 domain containing 5 | |
|
2 | 2 | ||||||
| MIRT719867 | CYP4F11 | cytochrome P450 family 4 subfamily F member 11 | |
|
2 | 2 | ||||||
| MIRT719967 | RBX1 | ring-box 1 | |
|
2 | 2 | ||||||
| MIRT723594 | FKRP | fukutin related protein | |
|
2 | 2 | ||||||
| MIRT725081 | VCPIP1 | valosin containing protein interacting protein 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|