>GBA2|NM_020944|3'UTR
   1 GCCGTCTGAACTGTGGGAGGGAAGTGCTAACAGCCCAGCCTCCAGCCTGGCCTTTCCTCCTTCCCCTCTGAACCTCCTGC
  81 AACCCTGAGCCATCAGGACAATCATACCCCTTCCCTTCTCTCCACCCAATTGTGCCAGTAAATGGGGGTTGAGGGTGACC
 161 TAGGCAGCATTAGAATCACTTATTTATTTCTTTCCTCACCTGTTCCCTGACTGCGTGAAATGTTCAGGGAGGTCAGTTGA
 241 TTTCCCCAGGTACATTCATGGTGTGACAGACACATGGGTACAAATAAAAGACCCAGAAAGCCAAAAAAAAAAAAAAAAAA
 321 AAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugaaagGGAAGUCUCGGACCGa 5' ||| | |||||||| Target 5' gcccagCCTCC--AGCCTGGCc 3'	33 - 52	152.00	-18.50
2	miRNA 3' ugAAAGGGA--AGUCUCGGACcga 5' ||||::| ||| |||| Target 5' taTTTCTTTCCTCA---CCTGttc 3'	185 - 205	94.00	-10.50
3	miRNA 3' ugaaagggaagucucGGA-CCGa 5' ||| ||| Target 5' gggggttgagggtgaCCTAGGCa 3'	144 - 166	88.00	-9.20

Mutant ID	Mutant Position	Mutant Source
COSN31562514	4	COSMIC
COSN30473541	65	COSMIC
COSN20076936	90	COSMIC
COSN15761822	106	COSMIC
COSN8520559	141	COSMIC
COSN28185107	143	COSMIC
COSN31605212	180	COSMIC
COSN30158367	269	COSMIC
COSN31611318	270	COSMIC
COSN30502016	300	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs186702075	1	dbSNP
rs747837125	3	dbSNP
rs1408408323	4	dbSNP
rs781470140	6	dbSNP
rs780899461	11	dbSNP
rs1233912055	12	dbSNP
rs1244965342	13	dbSNP
rs732784	14	dbSNP
rs372562411	17	dbSNP
rs1336568849	19	dbSNP
rs767673780	25	dbSNP
rs1245774556	26	dbSNP
rs1217454341	27	dbSNP
rs751208161	32	dbSNP
rs766034702	39	dbSNP
rs757950539	41	dbSNP
rs1357836094	46	dbSNP
rs953706983	49	dbSNP
rs1389261627	56	dbSNP
rs1234923409	57	dbSNP
rs1470701508	58	dbSNP
rs1177041717	63	dbSNP
rs1410019890	64	dbSNP
rs1003010507	67	dbSNP
rs1167565082	68	dbSNP
rs920969258	95	dbSNP
rs1403492428	101	dbSNP
rs1330773059	103	dbSNP
rs1355091079	106	dbSNP
rs762150608	107	dbSNP
rs1475862579	116	dbSNP
rs1286297960	120	dbSNP
rs546341042	124	dbSNP
rs971516173	125	dbSNP
rs974334885	126	dbSNP
rs963320399	129	dbSNP
rs112785437	130	dbSNP
rs764517257	141	dbSNP
rs971556515	143	dbSNP
rs1204799979	148	dbSNP
rs1250078722	149	dbSNP
rs13287359	160	dbSNP
rs1213572258	161	dbSNP
rs1486745944	163	dbSNP
rs1049100408	167	dbSNP
rs115645052	174	dbSNP
rs1013037877	178	dbSNP
rs528287633	183	dbSNP
rs1471838253	184	dbSNP
rs1169783858	186	dbSNP
rs1420134821	186	dbSNP
rs182108271	186	dbSNP
rs111496988	187	dbSNP
rs1037332661	190	dbSNP
rs768898931	190	dbSNP
rs532364442	192	dbSNP
rs560639241	197	dbSNP
rs903739878	207	dbSNP
rs1341005657	209	dbSNP
rs1042325861	212	dbSNP
rs945169716	214	dbSNP
rs932426169	215	dbSNP
rs914269576	231	dbSNP
rs912430042	237	dbSNP
rs1295073258	238	dbSNP
rs1340602853	239	dbSNP
rs1228340482	254	dbSNP
rs1050798984	259	dbSNP
rs1350459459	260	dbSNP
rs1212108144	265	dbSNP
rs1255720313	269	dbSNP
rs955871413	275	dbSNP
rs932425580	276	dbSNP
rs775952951	277	dbSNP
rs1242791326	278	dbSNP
rs770501648	286	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.