miRTarBase - #MIRT476517


—
pre-miRNA Information
pre-miRNA hsa-mir-873   
Genomic Coordinates chr9: 28888879 - 28888955
Synonyms MIRN873, hsa-mir-873, MIR873
Description Homo sapiens miR-873 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-873-3p
Sequence 46| GGAGACUGAUGAGUUCCCGGGA |67
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760528397 3 dbSNP
rs773403294 9 dbSNP
rs1273846238 13 dbSNP
rs1339396073 15 dbSNP
rs1247999695 18 dbSNP
rs377380148 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GABRB1   
Synonyms EIEE45
Description gamma-aminobutyric acid type A receptor beta1 subunit
Transcript NM_000812   
Expression
Putative miRNA Targets on GABRB1
3'UTR of GABRB1
(miRNA target sites are highlighted)		 
>GABRB1|NM_000812|3'UTR
   1 GGTCTGTTCTAATGGTTCCATTTAGACTACTTTCCTCTTCTATTGTTTTTTAACCTTACAGGTCCCCAACAGCGATACTG
  81 CTGTTTCTCGAGGTAAGAGATTCAGCCATCCAATTGGTTTTAGGTCTTGCATATCAGTTTTATTACTGCACCATGTTTAC
 161 TTCAAAAAGACAAAACAAAAAAAAAATTATTTTTCCAGTCTACCGTGGTCCAGGTTATCAGCTCTTTAAGAGCTCTATTA
 241 ATTGCCATGTTTACAAACAAACACAAAGAGAGAAGTTAGACAGGTAGATCTTTAGCAGTCTTTTCTAGTTTCCCTGGATT
 321 TCACTGATTTATTTTTTAGGGAAAATGAAAAGAGGACCTTGCTGTCCGCCTGCACTGCTTCCTGGTAAACTATAACAAAC
 401 TTATGCTGCCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGGCC--CUUG-AGUAGUCAGAGg 5'
            | ||  || | |:| ||||||: 
Target 5' gaCAGGTAGATCTTTAGCAGTCTTt 3'
 279 - 303 138.00 -11.50
2 
miRNA  3' agggcccUUGAGUA-----GUCAGAgg 5'
                 || |:||     ||||||  
Target 5' aaaaaaaAAATTATTTTTCCAGTCTac 3'
 177 - 203 127.00 -6.70
3 
miRNA  3' agggcccuUGAGUAGUCAGAGg 5'
                  :| :||||||:|: 
Target 5' taggtcttGCATATCAGTTTTa 3'
 121 - 142 122.00 -10.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30188073 3 COSMIC
COSN31600213 5 COSMIC
COSN29284499 7 COSMIC
COSN31501200 14 COSMIC
COSN30183540 19 COSMIC
COSN30514083 25 COSMIC
COSN30152781 26 COSMIC
COSN30102322 38 COSMIC
COSN30450894 41 COSMIC
COSN18729136 45 COSMIC
COSN30146734 67 COSMIC
COSN14113683 69 COSMIC
COSN26976991 74 COSMIC
COSN18718284 75 COSMIC
COSN30186276 79 COSMIC
COSN31612422 79 COSMIC
COSN1297839 85 COSMIC
COSN24383763 90 COSMIC
COSN19709404 91 COSMIC
COSN508369 97 COSMIC
COSN31501623 136 COSMIC
COSN28868144 187 COSMIC
COSN32064928 205 COSMIC
COSN20100028 305 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1471788158 1 dbSNP
rs776456940 2 dbSNP
rs1455729676 5 dbSNP
rs1339197576 7 dbSNP
rs745503672 8 dbSNP
rs1447756614 10 dbSNP
rs1282852852 12 dbSNP
rs769397165 14 dbSNP
rs774995285 16 dbSNP
rs373376360 21 dbSNP
rs769161799 23 dbSNP
rs1205033007 30 dbSNP
rs775033184 39 dbSNP
rs762453818 43 dbSNP
rs1185130440 44 dbSNP
rs376352619 45 dbSNP
rs1465023387 46 dbSNP
rs750877808 52 dbSNP
rs1464885482 55 dbSNP
rs1272951018 60 dbSNP
rs1329092137 63 dbSNP
rs544199293 69 dbSNP
rs1359099026 70 dbSNP
rs899694880 71 dbSNP
rs1036432184 75 dbSNP
rs553175666 79 dbSNP
rs997999417 88 dbSNP
rs1299846916 91 dbSNP
rs1436097864 96 dbSNP
rs762537059 98 dbSNP
rs1393974496 105 dbSNP
rs1324994702 109 dbSNP
rs1403369540 110 dbSNP
rs897903968 111 dbSNP
rs577415550 114 dbSNP
rs1474827414 130 dbSNP
rs1004502912 132 dbSNP
rs1189863306 144 dbSNP
rs1220012571 150 dbSNP
rs763675411 152 dbSNP
rs963346310 156 dbSNP
rs1453650700 159 dbSNP
rs570487863 164 dbSNP
rs1316975291 170 dbSNP
rs1197107518 172 dbSNP
rs1337947443 174 dbSNP
rs111359296 177 dbSNP
rs1276905715 177 dbSNP
rs1370594954 177 dbSNP
rs569240613 177 dbSNP
rs1281107055 180 dbSNP
rs1301489235 181 dbSNP
rs889382217 182 dbSNP
rs1332592106 185 dbSNP
rs1209948442 188 dbSNP
rs1409304057 189 dbSNP
rs192098838 205 dbSNP
rs1021867588 208 dbSNP
rs1034384807 215 dbSNP
rs1394139051 219 dbSNP
rs968402155 231 dbSNP
rs575157459 233 dbSNP
rs1194535350 238 dbSNP
rs1247664284 242 dbSNP
rs1181489737 244 dbSNP
rs993031570 263 dbSNP
rs1206009073 265 dbSNP
rs1476938820 266 dbSNP
rs10028945 271 dbSNP
rs1276847559 273 dbSNP
rs751183559 282 dbSNP
rs1345896389 283 dbSNP
rs1031465102 289 dbSNP
rs755405631 292 dbSNP
rs967665858 299 dbSNP
rs3832300 301 dbSNP
rs993076759 309 dbSNP
rs1409971412 312 dbSNP
rs1374338665 317 dbSNP
rs372181109 325 dbSNP
rs925641482 329 dbSNP
rs935638604 341 dbSNP
rs970397924 349 dbSNP
rs984076959 354 dbSNP
rs1471797505 356 dbSNP
rs1414924213 364 dbSNP
rs1298323744 368 dbSNP
rs1485597184 369 dbSNP
rs1235810128 372 dbSNP
rs1212280640 374 dbSNP
rs1443237080 376 dbSNP
rs147193608 379 dbSNP
rs1216348506 384 dbSNP
rs1290199411 385 dbSNP
rs1326806752 385 dbSNP
rs1228938376 387 dbSNP
rs1276251022 393 dbSNP
rs1300596825 394 dbSNP
rs1346143004 397 dbSNP
rs933698757 405 dbSNP
rs1317191714 409 dbSNP
rs1359421845 409 dbSNP
rs1277090594 410 dbSNP
rs1391309432 410 dbSNP
rs1491505846 410 dbSNP
rs1180682917 411 dbSNP
rs1209071008 411 dbSNP
rs1241810152 411 dbSNP
rs1269822795 411 dbSNP
rs1321104226 411 dbSNP
rs1378578012 411 dbSNP
rs1466371476 411 dbSNP
rs1491579356 411 dbSNP
rs59682924 411 dbSNP
rs1356511530 412 dbSNP
rs1218020899 413 dbSNP
rs1310447794 417 dbSNP
rs1229602614 421 dbSNP
rs1262509728 422 dbSNP
rs1379249583 422 dbSNP
rs562251554 423 dbSNP
rs1201193688 424 dbSNP
rs886903018 425 dbSNP
rs11731834 428 dbSNP
rs1348684133 428 dbSNP
rs1491044276 429 dbSNP
rs1248857360 430 dbSNP
rs1451587645 430 dbSNP
rs1491060750 430 dbSNP
rs909787910 430 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aggGCCCUUGAGUAGUCAGagg 5'
             || | :| |  :||||   
Target 5' ---CGCGUGC-CUGUAGUC--- 3'
 		1 - 15
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000295454.3 | 3UTR | CGCGUGCCUGUAGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081178 MIDN midnolin 2 4
MIRT109809 ZFX zinc finger protein, X-linked 2 4
MIRT242383 TMC5 transmembrane channel like 5 2 4
MIRT444003 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444097 SEPHS1 selenophosphate synthetase 1 2 2
MIRT446158 RPL12 ribosomal protein L12 2 2
MIRT446859 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT447275 FZD5 frizzled class receptor 5 2 2
MIRT447391 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT448817 FKBP1A FK506 binding protein 1A 2 4
MIRT450582 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT451776 USP36 ubiquitin specific peptidase 36 2 2
MIRT457961 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT458424 KLHL38 kelch like family member 38 2 4
MIRT461383 SLFN12L schlafen family member 12 like 2 2
MIRT467793 SLC2A14 solute carrier family 2 member 14 2 2
MIRT476517 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT480290 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT482745 HES7 hes family bHLH transcription factor 7 2 10
MIRT483189 HIST1H2AH histone cluster 1 H2A family member h 2 6
MIRT486545 DCTN4 dynactin subunit 4 2 2
MIRT486581 ZNF619 zinc finger protein 619 2 2
MIRT492604 POLR3E RNA polymerase III subunit E 2 2
MIRT494130 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT496023 ZBED3 zinc finger BED-type containing 3 2 2
MIRT497121 NBEAL1 neurobeachin like 1 2 2
MIRT497400 TMEM245 transmembrane protein 245 2 2
MIRT501410 RANBP10 RAN binding protein 10 2 2
MIRT510947 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT512494 ARID2 AT-rich interaction domain 2 2 2
MIRT512595 ZNF783 zinc finger family member 783 2 2
MIRT512612 CNTN4 contactin 4 2 2
MIRT517808 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT520686 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT526179 HEPH hephaestin 2 2
MIRT532568 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT533979 TADA2A transcriptional adaptor 2A 2 2
MIRT538622 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539703 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539806 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT540422 FAM83F family with sequence similarity 83 member F 2 2
MIRT540506 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540619 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT542423 ZNF331 zinc finger protein 331 2 2
MIRT542454 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT543383 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT544777 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT544923 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 2
MIRT549768 ZNF611 zinc finger protein 611 2 4
MIRT551242 COLEC10 collectin subfamily member 10 2 2
MIRT560474 ENSA endosulfine alpha 2 2
MIRT569738 GPR173 G protein-coupled receptor 173 2 2
MIRT571297 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT572345 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT573112 ERBB2IP erbb2 interacting protein 2 2
MIRT607744 ANGPT4 angiopoietin 4 2 2
MIRT607903 SPRYD4 SPRY domain containing 4 2 2
MIRT611744 SERPING1 serpin family G member 1 2 4
MIRT615101 BNC2 basonuclin 2 2 2
MIRT619124 CD40LG CD40 ligand 2 2
MIRT625572 ANKRD42 ankyrin repeat domain 42 2 2
MIRT629038 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633986 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635675 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637471 DEFB105B defensin beta 105B 2 4
MIRT637503 DEFB105A defensin beta 105A 2 4
MIRT639735 MAP2K2 mitogen-activated protein kinase kinase 2 2 2
MIRT640730 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645364 C9orf47 chromosome 9 open reading frame 47 2 2
MIRT647938 RNF152 ring finger protein 152 2 2
MIRT649400 SH2D4A SH2 domain containing 4A 2 2
MIRT656860 KIN Kin17 DNA and RNA binding protein 2 2
MIRT663470 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663507 NKAPL NFKB activating protein like 2 4
MIRT667690 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT677403 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT678682 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT678789 NUPL2 nucleoporin like 2 2 2
MIRT680649 KIAA1456 KIAA1456 2 2
MIRT682450 MTX3 metaxin 3 2 2
MIRT682740 CA6 carbonic anhydrase 6 2 2
MIRT684421 TUFT1 tuftelin 1 2 2
MIRT690535 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT690595 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690771 PLA2G2C phospholipase A2 group IIC 2 2
MIRT692233 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693667 MXRA7 matrix remodeling associated 7 2 2
MIRT695551 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695870 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT696214 LYZ lysozyme 2 2
MIRT698368 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT700795 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT701640 MYLK3 myosin light chain kinase 3 2 2
MIRT702989 HERPUD2 HERPUD family member 2 2 2
MIRT703627 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT703783 FAM102B family with sequence similarity 102 member B 2 2
MIRT704293 DDX19B DEAD-box helicase 19B 2 2
MIRT704828 CDC73 cell division cycle 73 2 2
MIRT705014 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT708480 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710770 PHF7 PHD finger protein 7 2 2
MIRT718918 TRIM66 tripartite motif containing 66 2 2
MIRT720390 ZNF549 zinc finger protein 549 2 2
MIRT720593 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT723515 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724458 PRKX protein kinase, X-linked 2 2
MIRT737267 UMAD1 UBAP1-MVB12-associated (UMA) domain containing 1 3 0
MIRT737356 ZIC2 Zic family member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-873 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-873 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-873 Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-873 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-873-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-873-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission