miRTarBase - #MIRT476945


—
pre-miRNA Information
pre-miRNA hsa-mir-379   
Genomic Coordinates chr14: 101022066 - 101022132
Synonyms MIRN379, hsa-mir-379, MIR379
Description Homo sapiens miR-379 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-379-5p
Sequence 6| UGGUAGACUAUGGAACGUAGG |26
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101022075 16594986, 18684997, 21912681, 22499667, 24964909, 25692236, 26449202, 27229138, 28411194, 28550310, 29267965, 20591823, 27587585, 30022565, 29976955, 31682236, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1316049475 1 dbSNP
rs775428399 3 dbSNP
rs61991156 7 dbSNP
rs748621194 16 dbSNP
rs72631818 17 dbSNP
rs750490770 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM83G   
Synonyms PAWS1
Description family with sequence similarity 83 member G
Transcript NM_001039999   
Expression
Putative miRNA Targets on FAM83G
3'UTR of FAM83G
(miRNA target sites are highlighted)		 
>FAM83G|NM_001039999|3'UTR
   1 CAGCATGTCCCAGCCTGGAGCCACACCTTCTGAGGCCCCAGCCCAGACTCATGACGCGGAGGGCAGACAGGCCGCCTGGG
  81 CCTACCAGAGCCCACTGGGACGGCAGGAAGGTGGGATGGGCGGGAGACGTTGGCACTCACCTGGTCGGTGCACCAGTACC
 161 AGGTGGCCATGATGGTCAGGCCAAAGGTCATCCCGGTCCACGGCAGGTCCCCTGTGTGGGGGTCTCGAAACATGTGCATG
 241 GCGTCTGTACGTGGCAGGTGGCAGGTGGTGTTGGCAATGGTCCTGGAGGGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggaugcaaGGUAUCAGAUGGu 5'
                  ||  :| ||||| 
Target 5' acaggccgCCTGGGCCTACCa 3'
 67 - 87 113.00 -13.60
2 
miRNA  3' ggaUGCA-AGGUAU--CAGAUGgu 5'
             || | | |||:  ||||::  
Target 5' gaaACATGTGCATGGCGTCTGTac 3'
 227 - 250 100.00 -8.50
3 
miRNA  3' ggaUGCA--AGGUAUCAGAUGgu 5'
             | ||  |||  :||| ||  
Target 5' caaAGGTCATCC-CGGTCCACgg 3'
 182 - 203 95.00 -6.74
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26975920 41 COSMIC
COSN18721969 42 COSMIC
COSN23738566 43 COSMIC
COSN30529643 56 COSMIC
COSN5414716 64 COSMIC
COSN30555678 104 COSMIC
COSN30103932 113 COSMIC
COSM7482404 133 COSMIC
COSM6578497 136 COSMIC
COSM7390712 144 COSMIC
COSM7678345 146 COSMIC
COSM5044027 155 COSMIC
COSM7905378 162 COSMIC
COSM976368 166 COSMIC
COSM7454403 179 COSMIC
COSM6783021 188 COSMIC
COSM1265978 189 COSMIC
COSM4438364 195 COSMIC
COSM6298225 199 COSMIC
COSM4878890 203 COSMIC
COSM9664814 209 COSMIC
COSM9753446 210 COSMIC
COSM9045120 212 COSMIC
COSM8999121 213 COSMIC
COSM4064576 235 COSMIC
COSM9507485 245 COSMIC
COSM9139511 251 COSMIC
COSM8437007 262 COSMIC
COSM8841433 278 COSMIC
COSM9393775 280 COSMIC
COSM4064574 283 COSMIC
COSM8959447 302 COSMIC
COSM9605024 303 COSMIC
COSM9476233 311 COSMIC
COSM3514993 315 COSMIC
COSM8245305 332 COSMIC
COSM472397 334 COSMIC
COSN20927136 398 COSMIC
COSN28643267 400 COSMIC
COSN30584951 409 COSMIC
COSN19636195 489 COSMIC
COSN18747681 511 COSMIC
COSN20072325 512 COSMIC
COSN1193847 559 COSMIC
COSN15104335 636 COSMIC
COSN25058092 688 COSMIC
COSN7161450 919 COSMIC
COSN20664558 1021 COSMIC
COSN7161449 1180 COSMIC
COSN1714894 1359 COSMIC
COSN28201552 1646 COSMIC
COSN7161448 1784 COSMIC
COSM229299 1968 COSMIC
COSM8257931 1972 COSMIC
COSM6404973 1975 COSMIC
COSM80539 1989 COSMIC
COSM4792034 2002 COSMIC
COSM6523353 2003 COSMIC
COSN24402885 2047 COSMIC
COSN24314256 2091 COSMIC
COSN28652604 2091 COSMIC
COSN28637530 2151 COSMIC
COSM6783041 2217 COSMIC
COSM976367 2219 COSMIC
COSM5055298 2220 COSMIC
COSM4064572 2229 COSMIC
COSM4551421 2233 COSMIC
COSM9090612 2234 COSMIC
COSM9302572 2242 COSMIC
COSM2741345 2246 COSMIC
COSM289038 2247 COSMIC
COSM7109498 2261 COSMIC
COSM4913141 2262 COSMIC
COSM8923888 2265 COSMIC
COSM7917111 2291 COSMIC
COSM5730620 2294 COSMIC
COSM112137 2295 COSMIC
COSM1128803 2295 COSMIC
COSM6863480 2301 COSMIC
COSN6654548 2335 COSMIC
COSN26439508 2371 COSMIC
COSN28189087 2392 COSMIC
COSN15730760 2438 COSMIC
COSN9656506 2484 COSMIC
COSN6100205 2492 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1460137693 2 dbSNP
rs766537391 5 dbSNP
rs1248489793 6 dbSNP
rs760717670 9 dbSNP
rs1329829091 10 dbSNP
rs1306227232 13 dbSNP
rs1188334844 14 dbSNP
rs1221962542 18 dbSNP
rs1381077138 21 dbSNP
rs962166953 21 dbSNP
rs1303200247 25 dbSNP
rs750318469 26 dbSNP
rs767417633 27 dbSNP
rs761521609 33 dbSNP
rs1457335889 34 dbSNP
rs200567364 35 dbSNP
rs778062940 35 dbSNP
rs768324935 36 dbSNP
rs1157565921 37 dbSNP
rs769719488 41 dbSNP
rs762559201 43 dbSNP
rs371943662 46 dbSNP
rs769279646 48 dbSNP
rs967294047 50 dbSNP
rs1317367810 51 dbSNP
rs748259346 51 dbSNP
rs1415645543 53 dbSNP
rs566888525 56 dbSNP
rs1166657521 57 dbSNP
rs1011347863 58 dbSNP
rs899622208 59 dbSNP
rs1365730431 73 dbSNP
rs753987702 74 dbSNP
rs201293728 75 dbSNP
rs369233218 90 dbSNP
rs778146294 91 dbSNP
rs781758793 93 dbSNP
rs772573560 94 dbSNP
rs748483821 95 dbSNP
rs890789740 98 dbSNP
rs376950895 101 dbSNP
rs183733514 102 dbSNP
rs1052704609 105 dbSNP
rs754093325 107 dbSNP
rs750816618 111 dbSNP
rs1383386169 113 dbSNP
rs1435285639 115 dbSNP
rs756147216 121 dbSNP
rs368621902 122 dbSNP
rs1459955817 123 dbSNP
rs767373432 128 dbSNP
rs374504492 129 dbSNP
rs1423154916 133 dbSNP
rs992243960 139 dbSNP
rs751392060 146 dbSNP
rs763852400 147 dbSNP
rs562861942 151 dbSNP
rs775117637 152 dbSNP
rs571295774 155 dbSNP
rs758980875 156 dbSNP
rs776158769 160 dbSNP
rs1221606747 161 dbSNP
rs772488731 162 dbSNP
rs748658648 165 dbSNP
rs779470869 172 dbSNP
rs1325481443 178 dbSNP
rs769132111 179 dbSNP
rs1489503949 182 dbSNP
rs114191272 184 dbSNP
rs1381397529 186 dbSNP
rs780432291 191 dbSNP
rs756306098 194 dbSNP
rs139582120 195 dbSNP
rs1303113505 200 dbSNP
rs781297592 201 dbSNP
rs757187308 202 dbSNP
rs751483618 208 dbSNP
rs765378838 209 dbSNP
rs757467227 212 dbSNP
rs1178443891 213 dbSNP
rs1490086257 213 dbSNP
rs1210677228 214 dbSNP
rs199714461 217 dbSNP
rs764343292 219 dbSNP
rs1268192687 222 dbSNP
rs150991947 224 dbSNP
rs375966413 226 dbSNP
rs762492720 227 dbSNP
rs772851089 231 dbSNP
rs769492030 233 dbSNP
rs1479130654 234 dbSNP
rs561246041 234 dbSNP
rs747784877 236 dbSNP
rs201487616 237 dbSNP
rs768299765 238 dbSNP
rs142677221 242 dbSNP
rs140682043 243 dbSNP
rs758362566 245 dbSNP
rs1018023639 248 dbSNP
rs1391200802 250 dbSNP
rs1387152915 253 dbSNP
rs1394733343 257 dbSNP
rs745873704 260 dbSNP
rs778951272 262 dbSNP
rs757377168 263 dbSNP
rs1302712284 265 dbSNP
rs1342094308 269 dbSNP
rs751963689 269 dbSNP
rs754028519 270 dbSNP
rs764407882 271 dbSNP
rs756384164 274 dbSNP
rs558112163 277 dbSNP
rs765487918 279 dbSNP
rs1437044271 290 dbSNP
rs767843725 293 dbSNP
rs1029477333 294 dbSNP
rs760113134 295 dbSNP
rs1237612957 297 dbSNP
rs1262010373 298 dbSNP
rs974848192 300 dbSNP
rs775051882 302 dbSNP
rs544692412 303 dbSNP
rs575765388 305 dbSNP
rs776102223 314 dbSNP
rs1489730618 320 dbSNP
rs768370920 323 dbSNP
rs746717664 324 dbSNP
rs775353427 332 dbSNP
rs745783630 333 dbSNP
rs757287574 336 dbSNP
rs200287025 338 dbSNP
rs1162721933 344 dbSNP
rs777797995 346 dbSNP
rs898774747 349 dbSNP
rs201298825 351 dbSNP
rs202027939 352 dbSNP
rs1315359984 355 dbSNP
rs1424704787 357 dbSNP
rs1322883305 359 dbSNP
rs752076277 360 dbSNP
rs1199216650 361 dbSNP
rs780620267 363 dbSNP
rs898827753 363 dbSNP
rs767018885 373 dbSNP
rs761352301 374 dbSNP
rs753395546 376 dbSNP
rs1205122737 382 dbSNP
rs1037338526 383 dbSNP
rs1349160638 387 dbSNP
rs113879606 388 dbSNP
rs760363889 394 dbSNP
rs1479989464 401 dbSNP
rs1175005839 406 dbSNP
rs111274831 407 dbSNP
rs1056620697 409 dbSNP
rs373804510 413 dbSNP
rs1384957494 415 dbSNP
rs550765572 416 dbSNP
rs796146417 416 dbSNP
rs968795229 420 dbSNP
rs1304681655 426 dbSNP
rs1021594558 430 dbSNP
rs1452597212 431 dbSNP
rs1313360088 435 dbSNP
rs1367727124 445 dbSNP
rs758937925 446 dbSNP
rs1229610817 448 dbSNP
rs1295802509 456 dbSNP
rs191085882 459 dbSNP
rs1201800669 464 dbSNP
rs1257288007 485 dbSNP
rs1461710793 491 dbSNP
rs1459686915 495 dbSNP
rs1203023457 498 dbSNP
rs946731286 501 dbSNP
rs1386712826 505 dbSNP
rs914531643 510 dbSNP
rs1473126190 511 dbSNP
rs988827946 522 dbSNP
rs1359879170 523 dbSNP
rs530597462 523 dbSNP
rs531093147 523 dbSNP
rs1469370681 543 dbSNP
rs1031323970 547 dbSNP
rs990029106 550 dbSNP
rs531825494 551 dbSNP
rs1270034090 557 dbSNP
rs906359120 558 dbSNP
rs1433075908 564 dbSNP
rs1212514146 566 dbSNP
rs1018081238 568 dbSNP
rs116312883 575 dbSNP
rs1222379411 578 dbSNP
rs549523143 578 dbSNP
rs955327244 588 dbSNP
rs1261131521 596 dbSNP
rs1209895680 606 dbSNP
rs111321066 607 dbSNP
rs1265851163 611 dbSNP
rs994276208 617 dbSNP
rs1207643117 626 dbSNP
rs1485011664 627 dbSNP
rs1193079634 630 dbSNP
rs1430253381 640 dbSNP
rs1329631729 643 dbSNP
rs560297356 648 dbSNP
rs1231025782 649 dbSNP
rs1037307354 652 dbSNP
rs1330424635 653 dbSNP
rs116025238 663 dbSNP
rs1388589663 670 dbSNP
rs1012514057 679 dbSNP
rs533493243 681 dbSNP
rs1343862070 682 dbSNP
rs372731745 684 dbSNP
rs564323650 688 dbSNP
rs761990266 689 dbSNP
rs1391331312 709 dbSNP
rs544430486 710 dbSNP
rs575453580 712 dbSNP
rs902632119 720 dbSNP
rs1171157299 721 dbSNP
rs1403738611 725 dbSNP
rs1280862417 737 dbSNP
rs1042475503 740 dbSNP
rs946753251 747 dbSNP
rs915251113 751 dbSNP
rs1038986816 755 dbSNP
rs555805462 757 dbSNP
rs746882533 764 dbSNP
rs3751969 767 dbSNP
rs1245609549 777 dbSNP
rs145993064 804 dbSNP
rs879048654 804 dbSNP
rs1254158443 806 dbSNP
rs951684523 807 dbSNP
rs1470792175 808 dbSNP
rs928694931 815 dbSNP
rs1286142610 818 dbSNP
rs1407393112 820 dbSNP
rs3751970 823 dbSNP
rs747965864 830 dbSNP
rs1300738761 831 dbSNP
rs1351859309 832 dbSNP
rs3180910 835 dbSNP
rs1442309583 838 dbSNP
rs918374522 839 dbSNP
rs972515197 842 dbSNP
rs1344307264 856 dbSNP
rs553535111 862 dbSNP
rs1236331131 863 dbSNP
rs115987627 867 dbSNP
rs1011903697 885 dbSNP
rs959641885 897 dbSNP
rs1035272925 898 dbSNP
rs1277053740 907 dbSNP
rs768668552 909 dbSNP
rs886096587 912 dbSNP
rs1051444670 917 dbSNP
rs1474085472 924 dbSNP
rs998134838 925 dbSNP
rs1385073215 926 dbSNP
rs902684220 926 dbSNP
rs571487024 931 dbSNP
rs947525463 935 dbSNP
rs557963621 937 dbSNP
rs1352661038 940 dbSNP
rs1053192815 945 dbSNP
rs934798303 948 dbSNP
rs1395810847 953 dbSNP
rs538012584 958 dbSNP
rs981469853 959 dbSNP
rs1428338540 962 dbSNP
rs1340349709 966 dbSNP
rs1195280803 968 dbSNP
rs1387825577 969 dbSNP
rs893873002 971 dbSNP
rs1449757594 973 dbSNP
rs1039039191 975 dbSNP
rs572835495 985 dbSNP
rs1243486811 986 dbSNP
rs148069437 989 dbSNP
rs1190937320 995 dbSNP
rs916511137 997 dbSNP
rs1475562701 999 dbSNP
rs1441646844 1001 dbSNP
rs1384320619 1003 dbSNP
rs1166805355 1006 dbSNP
rs1416844297 1009 dbSNP
rs990720212 1015 dbSNP
rs367801655 1021 dbSNP
rs1337238594 1022 dbSNP
rs1405301269 1023 dbSNP
rs1256534642 1033 dbSNP
rs1212981366 1053 dbSNP
rs1450123733 1055 dbSNP
rs549461766 1056 dbSNP
rs878867895 1057 dbSNP
rs778969785 1058 dbSNP
rs529411297 1066 dbSNP
rs1268476498 1070 dbSNP
rs1051022447 1073 dbSNP
rs933866083 1074 dbSNP
rs918437469 1078 dbSNP
rs1210940520 1080 dbSNP
rs1460412394 1080 dbSNP
rs559430073 1096 dbSNP
rs1005005262 1101 dbSNP
rs565445750 1108 dbSNP
rs909621936 1112 dbSNP
rs566847041 1120 dbSNP
rs1244268409 1121 dbSNP
rs959025850 1124 dbSNP
rs543665524 1126 dbSNP
rs1030385472 1127 dbSNP
rs373560725 1128 dbSNP
rs1003807628 1132 dbSNP
rs1160077876 1165 dbSNP
rs1385471301 1185 dbSNP
rs900196744 1187 dbSNP
rs967335913 1198 dbSNP
rs1370468803 1211 dbSNP
rs1021141861 1220 dbSNP
rs1306948606 1224 dbSNP
rs546710186 1227 dbSNP
rs1420956280 1228 dbSNP
rs1011877305 1240 dbSNP
rs893302853 1243 dbSNP
rs1053301721 1245 dbSNP
rs1011016263 1250 dbSNP
rs1259167507 1251 dbSNP
rs1490752124 1257 dbSNP
rs143585344 1261 dbSNP
rs542641074 1271 dbSNP
rs1007557364 1275 dbSNP
rs1368878455 1276 dbSNP
rs780251492 1280 dbSNP
rs1052168048 1283 dbSNP
rs1364312421 1285 dbSNP
rs1250991093 1294 dbSNP
rs1156648847 1303 dbSNP
rs1205708333 1320 dbSNP
rs915950365 1324 dbSNP
rs933939349 1328 dbSNP
rs990689237 1331 dbSNP
rs941960486 1338 dbSNP
rs909008322 1339 dbSNP
rs1308290739 1342 dbSNP
rs375460733 1344 dbSNP
rs530968800 1345 dbSNP
rs983320691 1351 dbSNP
rs756270603 1352 dbSNP
rs950488291 1354 dbSNP
rs1361146440 1358 dbSNP
rs1222840183 1360 dbSNP
rs561947812 1365 dbSNP
rs775824432 1370 dbSNP
rs941167525 1380 dbSNP
rs1251129979 1382 dbSNP
rs573983893 1387 dbSNP
rs148877718 1395 dbSNP
rs1011804055 1399 dbSNP
rs937710230 1401 dbSNP
rs927666702 1406 dbSNP
rs1445033241 1408 dbSNP
rs1163097002 1409 dbSNP
rs1289540583 1415 dbSNP
rs1444931796 1419 dbSNP
rs746268096 1423 dbSNP
rs573695592 1428 dbSNP
rs560079825 1429 dbSNP
rs1394750012 1434 dbSNP
rs967014412 1443 dbSNP
rs371201204 1450 dbSNP
rs999046819 1451 dbSNP
rs1471493457 1458 dbSNP
rs1383907081 1459 dbSNP
rs1021616484 1461 dbSNP
rs1245703286 1466 dbSNP
rs1313866288 1471 dbSNP
rs185241553 1474 dbSNP
rs1205974471 1483 dbSNP
rs1182845231 1487 dbSNP
rs958202325 1489 dbSNP
rs1471100540 1498 dbSNP
rs757658191 1513 dbSNP
rs1480263382 1516 dbSNP
rs1007609505 1521 dbSNP
rs577590350 1522 dbSNP
rs1244899491 1525 dbSNP
rs558051873 1526 dbSNP
rs1220911891 1529 dbSNP
rs1383592975 1531 dbSNP
rs1430559290 1540 dbSNP
rs1452474453 1549 dbSNP
rs1372635059 1552 dbSNP
rs890511257 1563 dbSNP
rs538149485 1564 dbSNP
rs1339187709 1574 dbSNP
rs1407508388 1577 dbSNP
rs1275289007 1581 dbSNP
rs1452308776 1586 dbSNP
rs1206998232 1593 dbSNP
rs1328932757 1596 dbSNP
rs577737961 1598 dbSNP
rs146714152 1607 dbSNP
rs897106203 1608 dbSNP
rs555638719 1615 dbSNP
rs1036950728 1617 dbSNP
rs1272634325 1634 dbSNP
rs1435126163 1638 dbSNP
rs941221435 1644 dbSNP
rs983801234 1645 dbSNP
rs1202761597 1646 dbSNP
rs888288787 1657 dbSNP
rs929135208 1658 dbSNP
rs923138774 1660 dbSNP
rs975850818 1666 dbSNP
rs1476857173 1672 dbSNP
rs1178703044 1674 dbSNP
rs964466810 1678 dbSNP
rs1430573842 1680 dbSNP
rs1469801975 1690 dbSNP
rs1174717265 1698 dbSNP
rs1347260098 1701 dbSNP
rs1431944385 1707 dbSNP
rs535925613 1718 dbSNP
rs566878762 1719 dbSNP
rs547092661 1726 dbSNP
rs1402436678 1734 dbSNP
rs539415248 1737 dbSNP
rs570520717 1742 dbSNP
rs1284691867 1743 dbSNP
rs868797456 1756 dbSNP
rs1324177805 1763 dbSNP
rs1222885162 1769 dbSNP
rs550814663 1773 dbSNP
rs1276427505 1774 dbSNP
rs1190483018 1777 dbSNP
rs927685663 1780 dbSNP
rs1254917323 1802 dbSNP
rs1216273427 1805 dbSNP
rs1260311076 1810 dbSNP
rs1487458060 1814 dbSNP
rs12940947 1822 dbSNP
rs12938841 1823 dbSNP
rs1031911852 1824 dbSNP
rs999551432 1825 dbSNP
rs1410846206 1833 dbSNP
rs907359190 1841 dbSNP
rs180965985 1845 dbSNP
rs112779390 1846 dbSNP
rs1417548618 1849 dbSNP
rs12938817 1851 dbSNP
rs12940928 1853 dbSNP
rs116488487 1854 dbSNP
rs1304414005 1855 dbSNP
rs1464588792 1856 dbSNP
rs1012913370 1864 dbSNP
rs528961850 1866 dbSNP
rs559966334 1867 dbSNP
rs1038304945 1868 dbSNP
rs1283341426 1874 dbSNP
rs1311028536 1878 dbSNP
rs112935959 1879 dbSNP
rs12939071 1884 dbSNP
rs1382428491 1890 dbSNP
rs188655299 1893 dbSNP
rs540340579 1894 dbSNP
rs1047639194 1899 dbSNP
rs1219499447 1906 dbSNP
rs759357692 1910 dbSNP
rs1317707626 1911 dbSNP
rs774223682 1912 dbSNP
rs770866627 1918 dbSNP
rs200950903 1925 dbSNP
rs1378912455 1927 dbSNP
rs758800741 1929 dbSNP
rs777901514 1929 dbSNP
rs1164878112 1930 dbSNP
rs769819385 1934 dbSNP
rs1384307583 1945 dbSNP
rs1181387157 1946 dbSNP
rs748376318 1947 dbSNP
rs1242266517 1948 dbSNP
rs201844800 1951 dbSNP
rs371624697 1957 dbSNP
rs943079145 1961 dbSNP
rs1292667177 1962 dbSNP
rs989697303 1963 dbSNP
rs564076607 1964 dbSNP
rs1359174829 1965 dbSNP
rs780644827 1966 dbSNP
rs758972826 1967 dbSNP
rs199908898 1970 dbSNP
rs1196603487 1971 dbSNP
rs1362914181 1974 dbSNP
rs1269713940 1975 dbSNP
rs750951541 1977 dbSNP
rs575641156 1978 dbSNP
rs760144236 1979 dbSNP
rs376166750 1982 dbSNP
rs1315942844 1983 dbSNP
rs954847925 1985 dbSNP
rs767179511 1988 dbSNP
rs200235814 1989 dbSNP
rs80176664 1992 dbSNP
rs762933035 1993 dbSNP
rs1005486320 1995 dbSNP
rs200878720 2001 dbSNP
rs1474157531 2006 dbSNP
rs1438883583 2007 dbSNP
rs1247876765 2014 dbSNP
rs1200792916 2015 dbSNP
rs1437485538 2016 dbSNP
rs1490325705 2020 dbSNP
rs773069077 2022 dbSNP
rs1184615782 2032 dbSNP
rs1207702300 2035 dbSNP
rs1308399968 2039 dbSNP
rs977666295 2040 dbSNP
rs769882456 2043 dbSNP
rs759299476 2046 dbSNP
rs185867215 2047 dbSNP
rs781509862 2048 dbSNP
rs753362342 2049 dbSNP
rs553150424 2050 dbSNP
rs373054604 2055 dbSNP
rs780554980 2056 dbSNP
rs758739925 2057 dbSNP
rs746355077 2062 dbSNP
rs1454360344 2065 dbSNP
rs570509089 2073 dbSNP
rs1002438188 2074 dbSNP
rs181409535 2078 dbSNP
rs1046574887 2079 dbSNP
rs1272155340 2080 dbSNP
rs1340073104 2082 dbSNP
rs1005630030 2088 dbSNP
rs945111821 2089 dbSNP
rs1482492478 2090 dbSNP
rs2074272 2091 dbSNP
rs1211482361 2092 dbSNP
rs1486925702 2094 dbSNP
rs1281914740 2097 dbSNP
rs1441063771 2097 dbSNP
rs1225538815 2098 dbSNP
rs1184876294 2102 dbSNP
rs1047514208 2112 dbSNP
rs1053358933 2125 dbSNP
rs1475428669 2126 dbSNP
rs993389260 2135 dbSNP
rs936947346 2138 dbSNP
rs910789103 2139 dbSNP
rs1470955889 2144 dbSNP
rs2074273 2151 dbSNP
rs1426729430 2152 dbSNP
rs1394070503 2154 dbSNP
rs755601753 2156 dbSNP
rs1327266649 2158 dbSNP
rs767087906 2164 dbSNP
rs754619596 2165 dbSNP
rs548887367 2168 dbSNP
rs77183401 2169 dbSNP
rs1054204165 2177 dbSNP
rs1232606866 2180 dbSNP
rs762692312 2182 dbSNP
rs773157298 2184 dbSNP
rs1224723506 2186 dbSNP
rs763832470 2189 dbSNP
rs879450849 2190 dbSNP
rs935755405 2195 dbSNP
rs377336455 2196 dbSNP
rs1281331253 2198 dbSNP
rs1285893633 2201 dbSNP
rs373214290 2203 dbSNP
rs368967767 2205 dbSNP
rs768917735 2207 dbSNP
rs747213031 2210 dbSNP
rs775896417 2211 dbSNP
rs772441687 2212 dbSNP
rs1468864190 2215 dbSNP
rs746241513 2216 dbSNP
rs779417895 2217 dbSNP
rs1420193208 2218 dbSNP
rs1407803265 2220 dbSNP
rs1175820086 2222 dbSNP
rs546334206 2225 dbSNP
rs868011168 2229 dbSNP
rs201314485 2230 dbSNP
rs749856991 2231 dbSNP
rs144232155 2233 dbSNP
rs754528010 2234 dbSNP
rs1217933307 2235 dbSNP
rs1464310429 2238 dbSNP
rs761569547 2239 dbSNP
rs373912084 2240 dbSNP
rs1221837157 2245 dbSNP
rs1231758177 2248 dbSNP
rs758159851 2250 dbSNP
rs1419399065 2251 dbSNP
rs750193850 2256 dbSNP
rs1296405873 2261 dbSNP
rs1367457792 2266 dbSNP
rs765149044 2281 dbSNP
rs1301129542 2282 dbSNP
rs1329908889 2283 dbSNP
rs1380016143 2284 dbSNP
rs1290113380 2286 dbSNP
rs1454802953 2290 dbSNP
rs1241588874 2291 dbSNP
rs564052153 2293 dbSNP
rs760084837 2294 dbSNP
rs776759928 2294 dbSNP
rs1215372222 2295 dbSNP
rs113107005 2296 dbSNP
rs760869365 2299 dbSNP
rs775806535 2300 dbSNP
rs199694829 2302 dbSNP
rs906367161 2307 dbSNP
rs553000350 2311 dbSNP
rs1266555692 2312 dbSNP
rs1250051354 2313 dbSNP
rs1187151042 2315 dbSNP
rs1183717358 2316 dbSNP
rs1486180924 2321 dbSNP
rs752247324 2324 dbSNP
rs370838338 2327 dbSNP
rs376674945 2330 dbSNP
rs749769587 2334 dbSNP
rs8415 2335 dbSNP
rs768110375 2336 dbSNP
rs1293061521 2337 dbSNP
rs746541384 2338 dbSNP
rs1053411911 2344 dbSNP
rs779694527 2345 dbSNP
rs1356789380 2346 dbSNP
rs757987561 2347 dbSNP
rs1382324286 2348 dbSNP
rs1360616961 2349 dbSNP
rs1287632577 2350 dbSNP
rs750150545 2352 dbSNP
rs778553064 2353 dbSNP
rs1163333758 2354 dbSNP
rs1330166817 2356 dbSNP
rs753788145 2357 dbSNP
rs556220147 2379 dbSNP
rs1251345921 2390 dbSNP
rs936334519 2392 dbSNP
rs1306564175 2398 dbSNP
rs1361211258 2400 dbSNP
rs1206230116 2402 dbSNP
rs910844814 2403 dbSNP
rs189814745 2404 dbSNP
rs1319530863 2410 dbSNP
rs1051125009 2412 dbSNP
rs1238749746 2421 dbSNP
rs144485136 2429 dbSNP
rs933556332 2431 dbSNP
rs1387280279 2434 dbSNP
rs1445542005 2436 dbSNP
rs553179735 2436 dbSNP
rs1366736950 2438 dbSNP
rs1040298530 2442 dbSNP
rs1233674793 2444 dbSNP
rs79373304 2449 dbSNP
rs745977382 2450 dbSNP
rs1400238514 2453 dbSNP
rs781756335 2456 dbSNP
rs1444993312 2458 dbSNP
rs940779781 2460 dbSNP
rs1384535824 2461 dbSNP
rs1286399247 2468 dbSNP
rs888916401 2475 dbSNP
rs1054291455 2477 dbSNP
rs1229005800 2484 dbSNP
rs576959646 2489 dbSNP
rs571458369 2490 dbSNP
rs1244811370 2495 dbSNP
rs1483463741 2496 dbSNP
rs1041496623 2498 dbSNP
rs1254369165 2501 dbSNP
rs958696223 2506 dbSNP
rs1456632176 2510 dbSNP
rs76465422 2517 dbSNP
rs1171278133 2519 dbSNP
rs537020289 2521 dbSNP
rs568131018 2524 dbSNP
rs1423493569 2525 dbSNP
rs1165842525 2527 dbSNP
rs916952284 2528 dbSNP
rs991692243 2529 dbSNP
rs937603609 2532 dbSNP
rs1301850545 2535 dbSNP
rs185380397 2536 dbSNP
rs984714540 2539 dbSNP
rs951468838 2561 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggaugcAAGGUAUCAGAUGGu 5'
                |||| | ||||||| 
Target 5' ------UUCC-U-GUCUACCu 3'
 		1 - 13
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000388995.6 | 3UTR | UUCCUGUCUACCUCGGGGUCAGGGCCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000388995.6 | 3UTR | CUUUUUCCUCUCCAGUCCAAAACACCUCACUGUUCCUGUCUACCUCGGGGUCAGGGCCCGGCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors 0.218 4.2e-2 0.208 5.0e-2 64 Click to see details
GSE19350 CNS germ cell tumors 0.45 7.1e-2 0.119 3.6e-1 12 Click to see details
GSE28544 Breast cancer -0.25 1.2e-1 -0.359 4.2e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.351 1.2e-1 -0.396 9.0e-2 13 Click to see details
GSE38226 Liver fibrosis 0.267 1.2e-1 0.245 1.4e-1 21 Click to see details
GSE17306 Multiple myeloma 0.146 1.6e-1 0.187 9.9e-2 49 Click to see details
GSE21032 Prostate cancer 0.087 2.2e-1 0.052 3.2e-1 83 Click to see details
GSE32688 Pancreatic cancer -0.137 2.3e-1 -0.051 3.9e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.053 4.0e-1 -0.023 4.6e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.997 0 0.800 0.1 4 Click to see details
HNSC -0.376 0.01 -0.389 0.01 42 Click to see details
UCEC -0.491 0.02 -0.593 0 19 Click to see details
LUAD -0.581 0.02 -0.615 0.02 12 Click to see details
STAD 0.284 0.06 0.317 0.04 32 Click to see details
ESCA -0.43 0.09 -0.282 0.2 11 Click to see details
KICH 0.25 0.11 0.331 0.05 25 Click to see details
COAD 0.435 0.14 0.286 0.25 8 Click to see details
LIHC 0.146 0.16 0.162 0.13 49 Click to see details
CESC -0.823 0.19 -1.000 0.5 3 Click to see details
LUSC -0.119 0.24 -0.095 0.29 38 Click to see details
PCPG 0.723 0.24 1.000 0.5 3 Click to see details
CHOL -0.224 0.28 -0.300 0.22 9 Click to see details
KIRC 0.07 0.29 0.057 0.32 68 Click to see details
PRAD -0.082 0.29 -0.077 0.3 50 Click to see details
BRCA -0.046 0.34 0.002 0.49 84 Click to see details
KIRP 0.07 0.35 0.067 0.36 32 Click to see details
BLCA 0.082 0.37 0.183 0.23 18 Click to see details
THCA 0.016 0.45 -0.028 0.42 59 Click to see details
THCA 0.016 0.45 -0.028 0.42 59 Click to see details
THCA 0.016 0.45 -0.028 0.42 59 Click to see details
70 hsa-miR-379-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007025 IL11 interleukin 11 1 1
MIRT068534 NHLRC3 NHL repeat containing 3 2 6
MIRT094166 PCGF3 polycomb group ring finger 3 2 6
MIRT100098 ABT1 activator of basal transcription 1 2 8
MIRT120926 PDE12 phosphodiesterase 12 2 8
MIRT179051 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT202043 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT215726 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT254608 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT266219 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT297447 SLC20A1 solute carrier family 20 member 1 2 4
MIRT315444 SLC16A10 solute carrier family 16 member 10 2 2
MIRT442137 C3orf17 nucleolus and neural progenitor protein 2 2
MIRT453878 IFRD1 interferon related developmental regulator 1 2 12
MIRT456258 TDRKH tudor and KH domain containing 2 12
MIRT456412 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT459729 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT461474 METTL1 methyltransferase like 1 2 2
MIRT463791 YBX1 Y-box binding protein 1 2 6
MIRT464031 WASL Wiskott-Aldrich syndrome like 2 2
MIRT464206 VGLL4 vestigial like family member 4 2 2
MIRT466712 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT467957 SLC16A1 solute carrier family 16 member 1 2 4
MIRT469224 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT473958 LRRC58 leucine rich repeat containing 58 2 2
MIRT475309 IFNLR1 interferon lambda receptor 1 2 2
MIRT476945 FAM83G family with sequence similarity 83 member G 2 4
MIRT477747 EDN1 endothelin 1 2 2
MIRT478260 DDX19B DEAD-box helicase 19B 2 2
MIRT478680 CSRP2 cysteine and glycine rich protein 2 2 4
MIRT490255 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT493289 LNPEP leucyl and cystinyl aminopeptidase 2 2
MIRT493564 HSPA5 heat shock protein family A (Hsp70) member 5 2 2
MIRT495960 TBC1D19 TBC1 domain family member 19 2 2
MIRT497106 BEST3 bestrophin 3 2 2
MIRT498348 CISD1 CDGSH iron sulfur domain 1 2 2
MIRT500783 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 8
MIRT501091 SLC5A6 solute carrier family 5 member 6 2 4
MIRT505309 TPD52 tumor protein D52 2 2
MIRT511107 NFIB nuclear factor I B 2 4
MIRT512737 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT514269 ZNF519 zinc finger protein 519 2 2
MIRT514602 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT515378 RPL7 ribosomal protein L7 2 2
MIRT518564 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT520459 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT529765 SF3B1 splicing factor 3b subunit 1 2 2
MIRT538005 DNAL1 dynein axonemal light chain 1 2 2
MIRT538250 CUL3 cullin 3 2 4
MIRT543777 RBM12B RNA binding motif protein 12B 2 4
MIRT546203 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT547201 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT548440 ELMOD2 ELMO domain containing 2 2 2
MIRT551634 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT553334 TSC22D2 TSC22 domain family member 2 2 2
MIRT556169 MCC mutated in colorectal cancers 2 2
MIRT557968 FAM222B family with sequence similarity 222 member B 2 2
MIRT560021 TM2D2 TM2 domain containing 2 2 2
MIRT560716 ZNF749 zinc finger protein 749 2 2
MIRT564114 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT564374 MRPS18B mitochondrial ribosomal protein S18B 2 2
MIRT566935 LIN28B lin-28 homolog B 5 2
MIRT573340 TUBD1 tubulin delta 1 2 2
MIRT607186 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT698515 TGFBR1 transforming growth factor beta receptor 1 2 2
MIRT704039 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT714582 PRRC1 proline rich coiled-coil 1 2 2
MIRT732163 PTK2 protein tyrosine kinase 2 3 1
MIRT732827 LINC00665 long intergenic non-protein coding RNA 665 3 0
MIRT735832 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-379 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-379 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
miR-379 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-379 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-379 Rifampicin approved 5381226 TaqMan low-density array hepatocellular carcinoma HepG2 cells 21540293 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 resistant
hsa-miR-379-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-379-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-379-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-379-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 resistant
hsa-miR-379-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-379-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-379-5p (3e)-3-[(6-methylimidazo[2,1-b]thiazol-5-yl)methylene]-1,3-dihydro-2h-indol-2-one 10755270 NSC726902 resistant
hsa-miR-379-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-379-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-379-5p (4-chlorophenyl) 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxylate 24204990 NSC733906 sensitive
hsa-miR-379-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-379-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-379-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-379-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-379-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-379-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-379-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-379-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-379-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-379-5p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 resistant
hsa-miR-379-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-379-5p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 sensitive
hsa-miR-379-5p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 resistant
hsa-miR-379-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-379-5p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 resistant
hsa-miR-379-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-379-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-379-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-379-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 386296 NSC678057 sensitive
hsa-miR-379-5p [4-[(4-bromophenyl)carbamothioyl]phenyl] n-(4-chlorophenyl)carbamate 5471250 NSC710003 resistant
hsa-miR-379-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-379-5p [5-[[2-chloroethyl(nitroso)carbamoyl]amino]-3-hydroxy-2-(hydroxymethyl)-6-methoxyoxan-4-yl] tetradecanoate 370169 NSC642913 sensitive
hsa-miR-379-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-379-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-379-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-379-5p 1-[(4-bromophenyl)amino]cyclopentanecarbonitrile 238637 NSC43101 resistant
hsa-miR-379-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 resistant
hsa-miR-379-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-379-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methylphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155808269 NSC762557 sensitive
hsa-miR-379-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-379-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-379-5p 1-cyclopentyl-3-[(Z)-1-pyridin-2-ylethylideneamino]thiourea 5468465 NSC670783 resistant
hsa-miR-379-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-379-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-379-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-379-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-379-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-379-5p 2-(2-(dimethylamino)ethylamino)naphthazarin 376950 NSC658145 resistant
hsa-miR-379-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-379-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-379-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-379-5p 2-[[4-[methyl-[(2,4,7-triaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid 387951 NSC682306 resistant
hsa-miR-379-5p 2-[2-(aziridin-1-yl)ethoxy]quinoline 268715 NSC109084 resistant
hsa-miR-379-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-379-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-379-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-379-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-379-5p 2-hydroxy discorhabdin d 362391 NSC626161 resistant
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-379-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-379-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-379-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-379-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-379-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-379-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-379-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-379-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-379-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-379-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-379-5p 3-[(e)-1-(2-hydroxy-4-methoxy-phenyl)ethylideneamino]-1,1-dimethyl-thiourea 135493996 NSC689547 resistant
hsa-miR-379-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 resistant
hsa-miR-379-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-379-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-379-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-379-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-379-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-379-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-379-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-379-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-379-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-379-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-379-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-379-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-379-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-379-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-379-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-379-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-379-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-379-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-379-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-379-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-379-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-379-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 resistant
hsa-miR-379-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-379-5p 5-methoxy-17-nitroso-8,9,10,12-tetrazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(17),2(7),3,5,8,11(16),12,14-octaene 54613484 NSC749292 resistant
hsa-miR-379-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-379-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-379-5p 5,10-dihydroxy-1-(4-piperidin-1-ylbutyl)naphtho[2,3-f]indole-4,11-dione 406505 NSC724632 resistant
hsa-miR-379-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-379-5p 5,11-dimethyl-2-[(pentanoyloxy)methyl]-6h-pyrido[4,3-b]carbazol-2-ium iodide 367409 NSC637130 sensitive
hsa-miR-379-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-379-5p 5.alpha.,25d-spirostan-3.beta.-ol glycoside NSC106557 sensitive
hsa-miR-379-5p 6-(2-(3-chlorophenyl)hydrazino)-2,4-pyrimidinediol 385879 NSC677279 resistant
hsa-miR-379-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-379-5p 6-[2-(dimethylamino)ethyl]-13-(2-isothiocyanatoethyl)-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 57327694 NSC757982 resistant
hsa-miR-379-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-379-5p 6-amino-5-[(4-fluorophenyl)methyl]-7-(1-methylbenzimidazol-2-yl)pyrrolo[2,3-b]pyrazine-2,3-dicarbonitrile 1179229 NSC730035 resistant
hsa-miR-379-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-379-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-379-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-379-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-379-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-379-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-379-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-379-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-379-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-379-5p 8-azainosine 135443893 NSC130279 resistant
hsa-miR-379-5p 8-chloro-7-methyl-5,5-dioxo-n-phenyl-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400657 NSC713019 sensitive
hsa-miR-379-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-379-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-379-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-379-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-379-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-379-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-379-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-379-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-379-5p Ak136303 388306 NSC682996 resistant
hsa-miR-379-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-379-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-379-5p Ao-267/15176074 393944 NSC696916 resistant
hsa-miR-379-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-379-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-379-5p Bis(2-nitrophenyl)sulfilimine 371591 NSC645984 resistant
hsa-miR-379-5p Carboplatin 38904 NSC241240 approved sensitive
hsa-miR-379-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-379-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-379-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-379-5p Crotonosid 223996 NSC12161 resistant
hsa-miR-379-5p Destruxin b NSC236580 resistant
hsa-miR-379-5p Dezaguanine 55710 NSC261726 resistant
hsa-miR-379-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-379-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-379-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-379-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-379-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-379-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-379-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-379-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-379-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-379-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-379-5p Gw701427a 10276395 NSC756323 sensitive
hsa-miR-379-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-379-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-379-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-379-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-379-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-379-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-379-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-379-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-379-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-379-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-379-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-379-5p Ls-94160 135408599 NSC52426 resistant
hsa-miR-379-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-379-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-379-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-379-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-379-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-379-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-379-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-379-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-379-5p Musennin 267361 NSC106554 sensitive
hsa-miR-379-5p N'-(cyano(4-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375017 NSC653843 sensitive
hsa-miR-379-5p N'-chloro-4-[2-[2-[4-[(Z)-N'-chlorocarbamimidoyl]phenoxy]ethyl-(4-methylphenyl)sulfonylamino]ethoxy]benzenecarboximidamide 45028721 NSC743909 sensitive
hsa-miR-379-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-379-5p N-(4-methylphenyl)-3-[3-(4-methylphenyl)imino-2-phenylinden-1-yl]sulfanyl-2-phenylinden-1-imine 389841 NSC686473 sensitive
hsa-miR-379-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-379-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 resistant
hsa-miR-379-5p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-379-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 resistant
hsa-miR-379-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-379-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-379-5p N-[2-(dimethylamino)ethyl]-4-(furo[3,2-c]quinolin-4-ylamino)benzamide 24204686 NSC732490 resistant
hsa-miR-379-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-379-5p N-[3-[(z)-n-methoxy-c-methylcarbonimidoyl]phenyl]-11h-indolo[3,2-c]quinolin-6-amine 9572585 NSC721041 resistant
hsa-miR-379-5p N-[dimethoxyphosphoryl(furan-2-yl)methyl]-4-[[4-[[dimethoxyphosphoryl(furan-2-yl)methyl]amino]phenyl]methyl]aniline 399251 NSC709928 sensitive
hsa-miR-379-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-379-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-379-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-379-5p Naphtho[2,1-b]quinolizinium, 7-methyl- chloride 5351151 NSC28002 sensitive
hsa-miR-379-5p Nigericin 34230 NSC292567 sensitive
hsa-miR-379-5p NSC372474 NSC372474 resistant
hsa-miR-379-5p NSC631451 NSC631451 resistant
hsa-miR-379-5p NSC751830 NSC751830 resistant
hsa-miR-379-5p NSC755523 NSC755523 resistant
hsa-miR-379-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-379-5p Paucin 282787 NSC136722 resistant
hsa-miR-379-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-379-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-379-5p Phosphinic acid, bis(1-aziridinyl)-, 2-naphthyl ester NSC55720 sensitive
hsa-miR-379-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-379-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-379-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-379-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-379-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-379-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-379-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-379-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-379-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-379-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-379-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-379-5p Stk134301 135400303 NSC715186 resistant
hsa-miR-379-5p Stl298328 387753 NSC681782 resistant
hsa-miR-379-5p Stl323102 375895 NSC656208 resistant
hsa-miR-379-5p Stl361983 256661 NSC83715 resistant
hsa-miR-379-5p Stl434863 394348 NSC697730 resistant
hsa-miR-379-5p Suavedol 65631 NSC141545 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-379-5p Thiosangivamycin 3006170 NSC105827 resistant
hsa-miR-379-5p Timtec1_002753 404248 NSC720426 sensitive
hsa-miR-379-5p Tridecyl 5-[(Z)-[3-methoxy-5-(1H-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1H-pyrrole-3-carboxylate 136226144 NSC763730 resistant
hsa-miR-379-5p Trimethyl-[[2-oxo-3-[(trimethylazaniumyl)methyl]cyclohexyl]methyl]azanium;iodide 360569 NSC622700 resistant
hsa-miR-379-5p Varacin trifluoroacetate salt 54611558 NSC722218 resistant
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved resistant
hsa-miR-379-5p Xestin a 5352066 NSC647638 resistant
hsa-miR-379-5p Xk-469 148183 NSC656889 sensitive
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved sensitive Low Malignant Pleural Mesothelioma cell line (MESO1)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-379-5p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Fluorouracil 3385 NSC19893 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-379-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-379-5p Ruxolitinib 25126798 NSC763371 approved resistant Low Myelofibrosis tissue
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, KU812)
hsa-miR-379-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (HCT116)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-379-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-379-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission