| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4776-1 |
| Genomic Coordinates | chr2: 212926257 - 212926336 |
| Description | Homo sapiens miR-4776-1 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| pre-miRNA | hsa-mir-4776-2 |
| Genomic Coordinates | chr2: 212926257 - 212926336 |
| Description | Homo sapiens miR-4776-2 stem-loop |
| Comment | None |
| RNA Secondary Structure | |
| Mature miRNA Information | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4776-5p | |||||||||||||||||||||||||||
| Sequence | 10| GUGGACCAGGAUGGCAAGGGCU |31 | |||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||
| Experiments | Illumina | |||||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | FADS1 | ||||||||||||||||||||
| Synonyms | D5D, FADS6, FADSD5, LLCDL1, TU12 | ||||||||||||||||||||
| Description | fatty acid desaturase 1 | ||||||||||||||||||||
| Transcript | NM_013402 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on FADS1 | |||||||||||||||||||||
| 3'UTR of FADS1 (miRNA target sites are highlighted) |
>FADS1|NM_013402|3'UTR 1 CAACAGCCACCCTGCCCAGTCTGGAAGAAGAGGAGGAAGACTCTGGAGCCAAGGCAGAGGGGAGCTTGAGGGACAATGCC 81 ACTATAGTTTAATACTCAGAGGGGGTTGGGTTTGGGGACATAAAGCCTCTGACTCAAACTCCTCCCTTTTATCTTCTAGC 161 CACAGTTCTAAGACCCAAAGTGGGGGGTGGACACAGAAGTCCCTAGGAGGGAAGGAGCTGTTGGGGCAGGGGTGTAAATT 241 ATTTCCTTTTTCTAGTTTGGCACATGCAGGTAGTTGGTGAACAGAGAGAACCAGGAGGGTAACAGAAGAGGAGGGACCTA 321 CTGAACCCAGAGTCAGGAAGAGATTTAACACTAAAATTCCACTCATGCCGGGCGTGGTGGCACGCGCCTGTAATCCCAGC 401 TACCCAGGAGGCTGAGGCAGGAGAATCGCTTGAACCGGGGAGGTGGAGGTTGCAGTGAGCTGAGATCACGCCATTGTACT 481 CCAGCCTGGGCGACAGAGCAAGACTCCATTTCAAAAAAAAAAAAAAAATCCACTCATATAAAAGGTGAGCTCAGCTCACT 561 GGTCCATTTCTCAGTGGCTTCTCCATCCTCATTTGCAAACCTCAGAGGGATAAGGCAGTTGAACCTGATGAGCAAGAATT 641 ATAACAGCAAGGAAACATTAATGCTTAGAATTCTGAGATCCAGCACAACTCAGTCTGTGGGAGCTCAGCTCGCTGCCCAG 721 GGATAGGTATGACCTATGTCTGCCTTAGGCTGCTGGGAGATGCCATTCTCCAGTTTCAGAAGCAGGCAGGGCAAAGGTCA 801 AGACTGTGGTATTGGGGTCTTTTGGCTCTGAAGGATCCTGGAACCACTGATTTTGGTTTATTCCCTCCAGGGTCTAAAGA 881 GAACAAGAGGTGCTAGCTCTTACCAAAACAGATGGTAGAGAGAGTTGCTGGCTATTTAAAAAGCTCTTTCATCTTTTAAT 961 TCACCTCTTCTTTTCACCTCTTTAACCACTCCTCAGGAACAGAACACTTCTAGGACTGGGGGTCTTTTAGCTCCATAAGC 1041 AAGTGAGCAGATGGGACAAGTTAGTCTTTTCTCCCTAGAAACAAAGGGGATGCCCAGTGGTTTCCCTTTGCTTCCCAACC 1121 TAAAATTTCAAGTTTAATAAAATAGCAATTAGCAGAAGTGACCAAATTGGGAGATAATTATCAGTCATGAGGAAAGACAC 1201 AGATTTCGGTCATAAAGAATGTAAGGGCTATAAGTAGAAACTTTCTATAACCTAAATGATGTTATAGAATTATTTTTGAG 1281 CAGGAGCAGAAAGATTAAATATGATCACTTCATACTTCTAAATCAGAAATAGGAAGATTAAAACCACAGAACAGTTTGTG 1361 ATTTCTATTGCTGTAGCTAGGTATCTTACTCTGTCCACTCTTGTTCAAGTATCTAACTCTTCTGGAAACCAAATAGGCTT 1441 TAGAAGAGATTATCCTATATTCCTATCAGTATAATACTAAAATGTAACTTTTTAATCATCTGGTTTTTAAAAGATAAACA 1521 GTTTAGCCCATCTCTCCAGAGAGCAAACATAGGAATATGACTCAGGAGCCTCCTAGGGCTTATCATCAGCCCTCACACCC 1601 GCTTCCCCCTCCAACCCACAGCCTTTGCTTCCAGGTGGCAGGATTACTACTTTGCCTCTTCAGCAGCATCTACTCTAGGC 1681 ATATTGATCATTTTAGACACTGGGAGAAGAGAACCTCAAACTAGGAGGAAAAGACAGAGCCTCCACTTAGTTTTGGGAGG 1761 GGATGGCAGACAGTCAAGGAGATGAGCGTCCTAAGGCATGTTGGGATAGGGTCAGATGCACCACCCATGGAGAGGTTTGT 1841 CAACACAAAGACATGGAAGGTTAGAGGTTTGTCAACAAAAAGACATGGAAGGTTAGGTTTGTCAACACAAAGACATGGAA 1921 GATTAGAGGTTTGTCAACACAAAGACACAGGAAGAATGGGCTGCAGAAGATTTAGATGTTTTCCATTTGGGCACATTTTA 2001 CTTAGCTGGAGAACTAGGTTTAAAACAGCCTGGGTAGGAAAATTAGAAGCAAGCTGGATGCAGTGGCTCATGCCTGTAAT 2081 CCCAACACTTTTGGGAGGTCCAGGCAGGAGGATCACTTGGGCCCAGGAGGTCAAGCCTGCAGCGAGCTGAGATCACACCA 2161 CTGCACTCCAGCCTGGGGTGATAGAACAAGACCCTGTCTCAAAAAAAAAAAAAACAACAAAAACTTAGAATTGAGGAGTT 2241 GTACCTCCATTGGCTTCCTCACTCCAAAATAGGTGCTGATCCTTCCTATTCCTATTCTTTGCCACCTTTTGGGTGTGGTG 2321 TCACCAGCCTGTTTAGCCAAGTAGCTTTGGGCATAGGCTGCCCAATCTGAGCAAACACCAGTGAGGCTCTATTGAGCCAA 2401 GACCAAGTCCTCAAAGCACCTGAACCACTGTGGCCTTCTCAGCCTACAGCAGTGTGGTCTCTTACATGGCCACAAAGGGA 2481 CACACAGTGACAAAAGGCTCGGAATGTTACAATGGTAAAATGAGTGATCTCAAATCCACTGACAGATATAAAATAGGCTT 2561 AGAGAGGAAAAGCTGCCTCTGGTCAAGTAGATCATGGCAGCATGAATTCCAACTCACTTTTTTACAACTCCAACTTCTAT 2641 GTTTATCTTTGTTACTTTCACTTTTTTACAACCTGGCCAGAGGCATTTTTTAAATCAGGCCCAATATCAGTATTCTTTTT 2721 GTGTGTGCCAATTTTGTTATCACATCCCTATGAAGTTGAAAAATAAAGTTAATTTTGACCAAAAGAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 3992.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 3992.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUCCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUCCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUCCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUCCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUCCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000350997.7 | 3UTR | CUCCUGGGUCCAAGCAAUUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000350997.7 | 3UTR | CCUCCUGGGUCCAAGCAAUUCUCCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
30 hsa-miR-4776-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT303862 | MAT2A | methionine adenosyltransferase 2A |  |
|
2 | 4 | ||||||
| MIRT445702 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
|
2 | 4 | ||||||
| MIRT451664 | KRT8 | keratin 8 | |
|
2 | 4 | ||||||
| MIRT456718 | TMEM239 | transmembrane protein 239 | |
|
2 | 2 | ||||||
| MIRT462899 | ZNRF3 | zinc and ring finger 3 | |
|
2 | 2 | ||||||
| MIRT469058 | RNF20 | ring finger protein 20 | |
|
2 | 2 | ||||||
| MIRT476392 | GDE1 | glycerophosphodiester phosphodiesterase 1 | |
|
2 | 8 | ||||||
| MIRT477147 | FADS1 | fatty acid desaturase 1 | |
|
2 | 8 | ||||||
| MIRT479187 | CLCN5 | chloride voltage-gated channel 5 | |
|
2 | 6 | ||||||
| MIRT480935 | BBX | BBX, HMG-box containing | |
|
2 | 8 | ||||||
| MIRT496801 | WNT2B | Wnt family member 2B | |
|
2 | 2 | ||||||
| MIRT503537 | SNTN | sentan, cilia apical structure protein | |
|
2 | 4 | ||||||
| MIRT507648 | CREBRF | CREB3 regulatory factor | |
|
2 | 4 | ||||||
| MIRT507918 | C2orf72 | chromosome 2 open reading frame 72 | |
|
2 | 4 | ||||||
| MIRT510817 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 4 | ||||||
| MIRT523221 | HIST1H3A | histone cluster 1 H3 family member a | |
|
2 | 2 | ||||||
| MIRT529829 | ARGFX | arginine-fifty homeobox | |
|
2 | 2 | ||||||
| MIRT532355 | SLC1A4 | solute carrier family 1 member 4 | |
|
2 | 2 | ||||||
| MIRT532401 | RAB44 | RAB44, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT535409 | PDZD8 | PDZ domain containing 8 | |
|
2 | 2 | ||||||
| MIRT566060 | RCC2 | regulator of chromosome condensation 2 | |
|
2 | 2 | ||||||
| MIRT571239 | FADS6 | fatty acid desaturase 6 | |
|
2 | 2 | ||||||
| MIRT611144 | TNRC6B | trinucleotide repeat containing 6B | |
|
2 | 4 | ||||||
| MIRT621399 | PYCRL | pyrroline-5-carboxylate reductase 3 | |
|
2 | 2 | ||||||
| MIRT647404 | SSTR3 | somatostatin receptor 3 | |
|
2 | 2 | ||||||
| MIRT654033 | SAMD12 | sterile alpha motif domain containing 12 | |
|
2 | 2 | ||||||
| MIRT659428 | COL1A1 | collagen type I alpha 1 chain | |
|
2 | 2 | ||||||
| MIRT662068 | ZNF284 | zinc finger protein 284 | |
|
2 | 2 | ||||||
| MIRT663830 | AGBL5 | ATP/GTP binding protein like 5 | |
|
2 | 4 | ||||||
| MIRT699963 | RREB1 | ras responsive element binding protein 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|