>EPHA2|NM_004431|3'UTR
   1 GCCTCGACAGGGCCTGGAGCCCCATCGGCCAAGAATACTTGAAGAAACAGAGTGGCCTCCCTGCTGTGCCATGCTGGGCC
  81 ACTGGGGACTTTATTTATTTCTAGTTCTTTCCTCCCCCTGCAACTTCCGCTGAGGGGTCTCGGATGACACCCTGGCCTGA
 161 ACTGAGGAGATGACCAGGGATGCTGGGCTGGGCCCTCTTTCCCTGCGAGACGCACACAGCTGAGCACTTAGCAGGCACCG
 241 CCACGTCCCAGCATCCCTGGAGCAGGAGCCCCGCCACAGCCTTCGGACAGACATATGGGATATTCCCAAGCCGACCTTCC
 321 CTCCGCCTTCTCCCACATGAGGCCATCTCAGGAGATGGAGGGCTTGGCCCAGCGCCAAGTAAACAGGGTACCTCAAGCCC
 401 CATTTCCTCACACTAAGAGGGCAGACTGTGAACTTGACTGGGTGAGACCCAAAGCGGTCCCTGTCCCTCTAGTGCCTTCT
 481 TTAGACCCTCGGGCCCCATCCTCATCCCTGACTGGCCAAACCCTTGCTTTCCTGGGCCTTTGCAAGATGCTTGGTTGTGT
 561 TGAGGTTTTTAAATATATATTTTGTACTTTGTGGAGAGAATGTGTGTGTGTGGCAGGGGGCCCCGCCAGGGCTGGGGACA
 641 GAGGGTGTCAAACATTCGTGAGCTGGGGACTCAGGGACCGGTGCTGCAGGAGTGTCCTGCCCATGCCCCAGTCGGCCCCA
 721 TCTCTCATCCTTTTGGATAAGTTTCTATTCTGTCAGTGTTAAAGATTTTGTTTTGTTGGACATTTTTTTCGAATCTTAAT
 801 TTATTATTTTTTTTATATTTATTGTTAGAAAATGACTTATTTCTGCTCTGGAATAAAGTTGCAGATGATTCAAACCGAAA
 881 AAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agGGGAA---GGGA---CGGUAUAGGAGu 5' :|:|| |||| ||| |||||| Target 5' ctTCTTTAGACCCTCGGGCCCCATCCTCa 3'	476 - 504	133.00	-22.10
2	miRNA 3' aggggAAGGGACGGUAUAGGAGu 5' ||:|: |:: | ||||| Target 5' atttaTTTCTAGTTCTTTCCTCc 3'	93 - 115	126.00	-11.69
3	miRNA 3' agGGGAAGGGACGGUAUAGGAGu 5' |:| || |||| ||||| Target 5' acCTCAAGCC--CCATTTCCTCa 3'	390 - 410	125.00	-19.90

Mutant ID	Mutant Position	Mutant Source
293404	166	ClinVar
293403	213	ClinVar
293402	224	ClinVar
876693	273	ClinVar
293401	284	ClinVar
293400	297	ClinVar
293399	355	ClinVar
293398	360	ClinVar
293397	443	ClinVar
293396	510	ClinVar
875702	543	ClinVar
293395	624	ClinVar
293394	625	ClinVar
293393	659	ClinVar
293392	668	ClinVar
293391	714	ClinVar
293390	742	ClinVar
293389	790	ClinVar
874766	845	ClinVar
COSN31495633	5	COSMIC
COSN20045328	21	COSMIC
COSN31603959	57	COSMIC
COSN30615848	96	COSMIC
COSN30511368	99	COSMIC
COSN30532999	113	COSMIC
COSN24389720	128	COSMIC
COSN31563035	136	COSMIC
COSN30513221	172	COSMIC
COSN31484355	444	COSMIC
COSN5733160	455	COSMIC
COSN24297937	529	COSMIC
COSN31609837	581	COSMIC
COSN31960181	659	COSMIC
COSN30289789	779	COSMIC
COSN31609559	809	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1441858816	2	dbSNP
rs770310016	5	dbSNP
rs746296877	6	dbSNP
rs1328353860	8	dbSNP
rs1263732342	9	dbSNP
rs757836462	20	dbSNP
rs747764578	26	dbSNP
rs374568579	27	dbSNP
rs918394523	31	dbSNP
rs754676889	35	dbSNP
rs1318906063	47	dbSNP
rs753511077	48	dbSNP
rs1332128065	49	dbSNP
rs754156201	50	dbSNP
rs1159313860	57	dbSNP
rs1421667478	71	dbSNP
rs1378641059	77	dbSNP
rs1158236404	81	dbSNP
rs1200989700	111	dbSNP
rs1039662473	124	dbSNP
rs972635865	128	dbSNP
rs1189421380	134	dbSNP
rs1006948332	141	dbSNP
rs572073959	142	dbSNP
rs373108711	151	dbSNP
rs904571558	152	dbSNP
rs1262916119	154	dbSNP
rs1283377605	162	dbSNP
rs11543935	166	dbSNP
rs760364834	167	dbSNP
rs1286295102	177	dbSNP
rs1243140536	193	dbSNP
rs1355377451	195	dbSNP
rs1264239568	202	dbSNP
rs755148306	203	dbSNP
rs370184274	206	dbSNP
rs1170642347	209	dbSNP
rs1406152777	211	dbSNP
rs1013637282	212	dbSNP
rs112600002	213	dbSNP
rs1031147847	220	dbSNP
rs886045504	224	dbSNP
rs570719791	227	dbSNP
rs1417001565	230	dbSNP
rs1364315813	236	dbSNP
rs938894319	239	dbSNP
rs550639263	240	dbSNP
rs879192942	244	dbSNP
rs927631917	245	dbSNP
rs1007004561	272	dbSNP
rs1208362952	273	dbSNP
rs1334638980	276	dbSNP
rs537231128	284	dbSNP
rs969554115	285	dbSNP
rs1428056611	293	dbSNP
rs568286286	296	dbSNP
rs1803527	297	dbSNP
rs1036848526	300	dbSNP
rs941194731	303	dbSNP
rs984277368	308	dbSNP
rs951283139	312	dbSNP
rs528206013	313	dbSNP
rs998083422	315	dbSNP
rs1478749159	321	dbSNP
rs1417361028	324	dbSNP
rs372137888	325	dbSNP
rs559346540	327	dbSNP
rs1191398289	332	dbSNP
rs552147972	337	dbSNP
rs916562102	340	dbSNP
rs1018237701	341	dbSNP
rs1200984338	349	dbSNP
rs140956748	355	dbSNP
rs1262636597	357	dbSNP
rs960811007	359	dbSNP
rs41269181	360	dbSNP
rs1043181485	373	dbSNP
rs1440406197	377	dbSNP
rs1331768866	388	dbSNP
rs999735533	393	dbSNP
rs1010722013	400	dbSNP
rs891984989	401	dbSNP
rs1057295370	407	dbSNP
rs1381441438	411	dbSNP
rs1191265374	417	dbSNP
rs938926993	422	dbSNP
rs1383336209	425	dbSNP
rs1238479721	427	dbSNP
rs1022980057	431	dbSNP
rs1479871302	433	dbSNP
rs113810531	443	dbSNP
rs889460750	444	dbSNP
rs1211474321	455	dbSNP
rs1314506161	460	dbSNP
rs1450416987	461	dbSNP
rs1044757627	465	dbSNP
rs1354673521	469	dbSNP
rs1050745554	484	dbSNP
rs947788043	491	dbSNP
rs909533787	502	dbSNP
rs983916095	503	dbSNP
rs896948419	504	dbSNP
rs144559615	510	dbSNP
rs1036732037	512	dbSNP
rs918438601	516	dbSNP
rs976526542	522	dbSNP
rs1244186360	531	dbSNP
rs1380471238	538	dbSNP
rs561159937	547	dbSNP
rs1444804130	548	dbSNP
rs941206204	553	dbSNP
rs909676961	555	dbSNP
rs965266981	557	dbSNP
rs1460398212	559	dbSNP
rs1018185554	562	dbSNP
rs985772370	579	dbSNP
rs968776397	580	dbSNP
rs1210167764	586	dbSNP
rs1488664036	590	dbSNP
rs1288364650	593	dbSNP
rs1237117098	596	dbSNP
rs1316607552	597	dbSNP
rs1181210271	601	dbSNP
rs541085522	602	dbSNP
rs1228743667	603	dbSNP
rs1357217219	608	dbSNP
rs1481617976	614	dbSNP
rs948636431	621	dbSNP
rs917142351	622	dbSNP
rs886045503	624	dbSNP
rs886045502	625	dbSNP
rs368994858	639	dbSNP
rs1360406765	657	dbSNP
rs572208071	658	dbSNP
rs139754494	659	dbSNP
rs1003003580	662	dbSNP
rs1425929726	667	dbSNP
rs146367469	668	dbSNP
rs1044687963	670	dbSNP
rs1187891355	671	dbSNP
rs942265546	679	dbSNP
rs1022430584	680	dbSNP
rs1393767560	684	dbSNP
rs1485663147	691	dbSNP
rs576390680	692	dbSNP
rs557194943	693	dbSNP
rs536963349	696	dbSNP
rs1297086125	697	dbSNP
rs1221960796	703	dbSNP
rs796156874	713	dbSNP
rs78569898	714	dbSNP
rs1029866772	730	dbSNP
rs1297077023	734	dbSNP
rs1380090283	737	dbSNP
rs1383711796	738	dbSNP
rs539294758	741	dbSNP
rs111512184	742	dbSNP
rs879068624	747	dbSNP
rs918296109	755	dbSNP
rs748903065	756	dbSNP
rs534862493	760	dbSNP
rs1232976007	774	dbSNP
rs1164721914	779	dbSNP
rs1466590645	780	dbSNP
rs1015298936	781	dbSNP
rs943907724	789	dbSNP
rs1005278659	790	dbSNP
rs371642899	790	dbSNP
rs565773014	791	dbSNP
rs948542654	794	dbSNP
rs985415362	803	dbSNP
rs895777501	806	dbSNP
rs969014089	806	dbSNP
rs1421380721	807	dbSNP
rs1248567786	808	dbSNP
rs1325368901	809	dbSNP
rs1021638836	814	dbSNP
rs1442606714	815	dbSNP
rs578205829	815	dbSNP
rs1325647421	816	dbSNP
rs978182536	821	dbSNP
rs552021933	837	dbSNP
rs946847502	840	dbSNP
rs181703453	845	dbSNP
rs956757299	846	dbSNP
rs1219991862	856	dbSNP
rs532111236	867	dbSNP
rs1358379520	876	dbSNP
rs956113132	877	dbSNP
rs1035817591	879	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.