| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-605 |
| Genomic Coordinates | chr10: 51299573 - 51299655 |
| Synonyms | MIRN605, hsa-mir-605, MIR605 |
| Description | Homo sapiens miR-605 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-605-3p | ||||||||||||||||||||||||||||
| Sequence | 51| AGAAGGCACUAUGAGAUUUAGA |72 | ||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||
| Experiments | Illumina | ||||||||||||||||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | CTNND1 | ||||||||||||||||||||
| Synonyms | CAS, CTNND, P120CAS, P120CTN, p120, p120(CAS), p120(CTN) | ||||||||||||||||||||
| Description | catenin delta 1 | ||||||||||||||||||||
| Transcript | NM_001085458 | ||||||||||||||||||||
| Other Transcripts | NM_001085459 , NM_001085460 , NM_001085461 , NM_001085462 , NM_001085463 , NM_001085464 , NM_001085465 , NM_001085466 , NM_001085467 , NM_001085468 , NM_001085469 , NM_001331 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on CTNND1 | |||||||||||||||||||||
| 3'UTR of CTNND1 (miRNA target sites are highlighted) |
>CTNND1|NM_001085458|3'UTR 1 CACCACTATCTCCGTTCCATCTGGGCTTATATGTACTTTTATTTTTTGGTGGTGAAATTGACTGATGATTTTCCTTTTTC 81 TTCGCTGGACTATTGTGCCAACTGCCAGGCTGCCTCCTGCCCTTACAGCCCTAAGTGGCTGCCTTCTTTCCATCAACTCC 161 CAACTTCTTCCTGTGAAGTTTAATTGTCTCAACGCCTCCCCCTCCCCCATTCCCTCCATTTTTCTCCCAAGAAACCTGAC 241 TCAATTATTTGCATATTTTGAGAAACTGCTGCAGATTAGTTCTTTTTGCCAGTTTTCCCTGGAACTCCTGGCCTTTTGTG 321 GAGGGGAGGGATGGAGAGAATAGGAATCTTCACTAGAAGCCGTGGGAAGAATTGGAAGTTACATGCTGTATATGCAATGT 401 CCAGCAGTCTGATAAACTGACGATTCTTAATCAAGATTTTTTTCCTGATGGGGAAGGGACTTTTATTTTCTTTTAGAGAG 481 GGGAAAGTGTGAGCTCTTCCCTTATTCCTAATGGCTATTTTTGAAGCAAAGAAGGCCAGCAACATTGGCACATGCCACCT 561 GGCAAAGGACCCTTGAGTAAGTGAAGGTCTCCTAAAACTGGGATTAAGAAACCTTGCTCTCCTCATCTCCAAGGCAGGGA 641 CCATCAAGAACCTACAGACTCCATCTCTTCTGCAAGCCTCATGCCAACCCTGGGCTATTGCTGCTGCCCCTTAAACACAG 721 GCTGTCCTTAACCCACCTCTCCTGCCCTGTGATATGTCTGCTGAGTTGGCCTGGCCATTTCCAAGAGGCTGTAGAAAGGG 801 GAGAATGTCAAGGAAGACTTTTGGTAGAGAAGGAGCAGAAAGATGTGTTTTTGGGAAGAAGAAGACCTCTAGGAGGAGCT 881 AGTAGGAATGTACATGAAGCAATTAGTCTGAAACTGGCTTCCCCACTCCCCCGTTTCTCCTTTTCCTATCCTTATAGGCC 961 TGTCCCTTGCCTCTGCCCTGGATTGGTTGGCAAACTAAAGGACTTGATGTACATAACTCCTGTCCCTTTTCCCTTACAAG 1041 GTGGGGATTGCCCCTGGCTTTGCCTCTTCTTTGTGCCTTTGGCCTGGGGTGCATCTCCTCCCGCCCTTCCATGTGCCTTT 1121 CTTTGCCTCTGCAGTCTCATTTCTCATAATTTTGCAAATTATATTTTGTTGCTTTCTTACCTACTATTGGCCCTAAATAG 1201 CAGAAAGAAGAGAAGTGACCGAGAGAACCTCAGATTCTTCATTGAGGATTGGTATAGCCATGATTTCAGTCATAGCAAGC 1281 TTTTGCTCAACAGCATATGGGTGGGATTTTGCAAAAATCCTATTCTGATGAATCTCAAAGTAAGGCTGGTAAGAGAAGTG 1361 AGTGGTGTGACTCTTACTCCTTAGGTGCCCAGAATTTACCATCATCTCTGAAGGAGTTACAGGGAAGTGGTCTCCCCAAT 1441 TCTCCCCTCCCTCCAGTATTGCCCCCTCTCACTTTAGCATATATTAATTAGCAGGTTGGGCTAGAGAAATCAGCTGCTAT 1521 GCGGGTTGATTATTATTATTATTTCTAATCCTTTTCCTTATTTGCCTTCTACTCCCCTTAATCTAATCTAAAAGCTCTGT 1601 TCCATGCAACTGGAGTTCCTTATCCCTCTCTTCCCCTTCCCTTATATATTGAGGCTATGGGGTAGGAGAAAAGTGCACAA 1681 CCCACCACCCCCTTTACTCGTGCATTAAAATTTCTTATTTACCCTTTTCCCCCTTCCCATTTCTTCCCACTTTCATCTAC 1761 CTTTTCTGGCAAAAAGGAGCCTTTTGCTCTCTGTGACCCTAAGAGCACACTGCACAGGGAAAATTGCCCCATCCAGACCT 1841 GGCTCCACTCTTGATCTCTCTTGTCCTCTTCTGCTCTTTTCCTGGTGCTCTTTTTTCTCGGTGGGGTGTGGGTAATAGAA 1921 CAGCCGTGGGCTTTTGGGGACCTTTAACTTTTTTTTCTCTCTTTTGTTTATAAAAAACACTAAACATTCAATTCCAGAGA 2001 ACCAAAAATCCCACCTTCCCACCGAACACTACTAAGGGGCTTGTGTTCTGCTCCATACCTTTTCTCTTTTCTTTCTGTCT 2081 TGTTAATGCTTTTAAAAACAAATGAGTTTTTTATATAAATAAAGTTTTTAAAGTGTGTATGTGGGGGGTCTGTGTCATTT 2161 CTTCACTTCAAGCTGTTATTTCTTCCCTGCTTTGCATCTTTGTTACTTCCTTATGTATCAGTGTCCTTTCCAGAGCAACC 2241 AGAAGGAGGTTATACCAGGATTTATTTTGAGCTCAGCCCCAACTCTTTATCAAGCAACATTCTTGTTAACTATATGTGAA 2321 ACATTTTTTCTTCTGAAGATTCTTAAAAATTGAATGTGGCTGAAGTTGAACATGGGAGCTTATTGCTAATTTAGAGATAG 2401 GAAACTGAAGCATAAAGAATTAATGACTTACTTTAATTACTGGAATTCTTCTGCAACATTTGACAAAACTAACCTTGAAT 2481 AAGGCCCACTGTAATACGTAGCTCTCTTAAATATAACACTTAGGACTAGAAGATTAGAAACTACCAATCCCAACTACGTA 2561 ATAGGAAAATGTAGGATCAAAAGGCCCATGTATATAAGTACTGACCACTGGGCCATAATGTTGCTTCTCAGGCTATATGC 2641 AGTCCTTTAGTCAGAAGTCAATAGGCCTATTTATTAATATTTTACAGACCATATTACCTGGATTACCAGGGACTATCTTT 2721 GCTGCAGAGATCAAGGGTTAAGATCTATGGGAAGATACTTATTTTTCTGAGGTCCTTATGTCCTGTCATATAATTAAAGA 2801 CTCAAGAGAATTTATGTGAAATGCTTTCTGTATGCCCAAATCTTTAGATTAAAATTATATAGCTGCTCCTGAAAAAAAAA 2881 AAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | hESCs (WA-09) | ||||||
| Disease | 1500.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2
PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000524630.1 | 3UTR | AAUCCUUUUCCUUAUUUGCCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000524630.1 | 3UTR | CCUUCUUUCCAUCAACUCCCAACUUCUUCCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
100 hsa-miR-605-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT061339 | WEE1 | WEE1 G2 checkpoint kinase |  |
|
2 | 4 | ||||||
| MIRT061584 | BTG2 | BTG anti-proliferation factor 2 | |
|
2 | 6 | ||||||
| MIRT076140 | WDR81 | WD repeat domain 81 | |
|
2 | 2 | ||||||
| MIRT079361 | CCDC137 | coiled-coil domain containing 137 | |
|
2 | 2 | ||||||
| MIRT079547 | VAMP3 | vesicle associated membrane protein 3 | |
|
2 | 2 | ||||||
| MIRT096242 | CANX | calnexin | |
|
2 | 2 | ||||||
| MIRT243877 | G3BP1 | G3BP stress granule assembly factor 1 | |
|
2 | 4 | ||||||
| MIRT249186 | AKIRIN1 | akirin 1 | |
|
2 | 8 | ||||||
| MIRT273604 | SP1 | Sp1 transcription factor | |
|
2 | 2 | ||||||
| MIRT316766 | FOXC1 | forkhead box C1 | |
|
2 | 4 | ||||||
| MIRT322410 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | |
|
2 | 2 | ||||||
| MIRT370117 | TRIB3 | tribbles pseudokinase 3 | |
|
2 | 2 | ||||||
| MIRT392725 | UBN2 | ubinuclein 2 | |
|
2 | 2 | ||||||
| MIRT406910 | PTBP1 | polypyrimidine tract binding protein 1 | |
|
2 | 2 | ||||||
| MIRT407440 | CTDSP1 | CTD small phosphatase 1 | |
|
2 | 2 | ||||||
| MIRT441887 | RD3 | retinal degeneration 3 | |
|
2 | 4 | ||||||
| MIRT444979 | C15orf52 | chromosome 15 open reading frame 52 | |
|
2 | 2 | ||||||
| MIRT445241 | FOXD4 | forkhead box D4 | |
|
2 | 2 | ||||||
| MIRT445500 | FOXD4L5 | forkhead box D4 like 5 | |
|
2 | 2 | ||||||
| MIRT445503 | FOXD4L4 | forkhead box D4 like 4 | |
|
2 | 2 | ||||||
| MIRT447025 | FOXD4L1 | forkhead box D4 like 1 | |
|
2 | 2 | ||||||
| MIRT447743 | TMCC3 | transmembrane and coiled-coil domain family 3 | |
|
2 | 2 | ||||||
| MIRT448761 | HDX | highly divergent homeobox | |
|
2 | 2 | ||||||
| MIRT450003 | HAX1 | HCLS1 associated protein X-1 | |
|
2 | 2 | ||||||
| MIRT452830 | FAM131B | family with sequence similarity 131 member B | |
|
2 | 2 | ||||||
| MIRT452872 | LAX1 | lymphocyte transmembrane adaptor 1 | |
|
2 | 2 | ||||||
| MIRT453506 | ARRB1 | arrestin beta 1 | |
|
2 | 2 | ||||||
| MIRT454169 | HIST1H2BK | histone cluster 1 H2B family member k | |
|
2 | 2 | ||||||
| MIRT458742 | CES2 | carboxylesterase 2 | |
|
2 | 2 | ||||||
| MIRT459166 | HSPA6 | heat shock protein family A (Hsp70) member 6 | |
|
2 | 21 | ||||||
| MIRT460246 | IL17RB | interleukin 17 receptor B | |
|
2 | 4 | ||||||
| MIRT460514 | SDE2 | SDE2 telomere maintenance homolog | |
|
2 | 2 | ||||||
| MIRT460698 | RNF157 | ring finger protein 157 | |
|
2 | 2 | ||||||
| MIRT461481 | METTL1 | methyltransferase like 1 | |
|
2 | 2 | ||||||
| MIRT462617 | C20orf27 | chromosome 20 open reading frame 27 | |
|
2 | 4 | ||||||
| MIRT463233 | ZNF131 | zinc finger protein 131 | |
|
2 | 2 | ||||||
| MIRT465699 | TNPO2 | transportin 2 | |
|
2 | 8 | ||||||
| MIRT466304 | TIMM22 | translocase of inner mitochondrial membrane 22 | |
|
2 | 2 | ||||||
| MIRT468957 | RPS14 | ribosomal protein S14 | |
|
2 | 6 | ||||||
| MIRT469571 | RARA | retinoic acid receptor alpha | |
|
2 | 2 | ||||||
| MIRT469685 | RAB5B | RAB5B, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT470800 | PMP22 | peripheral myelin protein 22 | |
|
2 | 2 | ||||||
| MIRT471649 | PANK2 | pantothenate kinase 2 | |
|
2 | 4 | ||||||
| MIRT471722 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | |
|
2 | 2 | ||||||
| MIRT472281 | NFIB | nuclear factor I B | |
|
2 | 4 | ||||||
| MIRT473680 | MAPKBP1 | mitogen-activated protein kinase binding protein 1 | |
|
2 | 2 | ||||||
| MIRT475859 | H6PD | hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase | |
|
2 | 2 | ||||||
| MIRT477326 | EPHA2 | EPH receptor A2 | |
|
2 | 2 | ||||||
| MIRT477831 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | |
|
2 | 2 | ||||||
| MIRT478572 | CTNND1 | catenin delta 1 | |
|
2 | 4 | ||||||
| MIRT479634 | CD81 | CD81 molecule | |
|
2 | 2 | ||||||
| MIRT481950 | ANKRD11 | ankyrin repeat domain 11 | |
|
2 | 2 | ||||||
| MIRT483696 | ZNF74 | zinc finger protein 74 | |
|
2 | 6 | ||||||
| MIRT488798 | MALT1 | MALT1 paracaspase | |
|
2 | 2 | ||||||
| MIRT489066 | STARD3 | StAR related lipid transfer domain containing 3 | |
|
2 | 2 | ||||||
| MIRT492533 | PSMD11 | proteasome 26S subunit, non-ATPase 11 | |
|
2 | 2 | ||||||
| MIRT492857 | NRARP | NOTCH regulated ankyrin repeat protein | |
|
2 | 2 | ||||||
| MIRT496793 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | |
|
2 | 2 | ||||||
| MIRT500122 | ZNF106 | zinc finger protein 106 | |
|
2 | 4 | ||||||
| MIRT505359 | TMEM167A | transmembrane protein 167A | |
|
2 | 2 | ||||||
| MIRT506786 | KLHL15 | kelch like family member 15 | |
|
2 | 6 | ||||||
| MIRT510692 | SRM | spermidine synthase | |
|
2 | 6 | ||||||
| MIRT515841 | CEP104 | centrosomal protein 104 | |
|
2 | 4 | ||||||
| MIRT516448 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | |
|
2 | 4 | ||||||
| MIRT528855 | PKP1 | plakophilin 1 | |
|
2 | 2 | ||||||
| MIRT533848 | TET3 | tet methylcytosine dioxygenase 3 | |
|
2 | 2 | ||||||
| MIRT539025 | ATXN7L1 | ataxin 7 like 1 | |
|
2 | 4 | ||||||
| MIRT542872 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | |
|
2 | 2 | ||||||
| MIRT546543 | SATB2 | SATB homeobox 2 | |
|
2 | 2 | ||||||
| MIRT554114 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | |
|
2 | 2 | ||||||
| MIRT560569 | ZNF460 | zinc finger protein 460 | |
|
2 | 2 | ||||||
| MIRT560796 | EPM2AIP1 | EPM2A interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT562836 | GCFC2 | GC-rich sequence DNA-binding factor 2 | |
|
2 | 2 | ||||||
| MIRT563109 | IFRD2 | interferon related developmental regulator 2 | |
|
2 | 2 | ||||||
| MIRT564177 | MRPL49 | mitochondrial ribosomal protein L49 | |
|
2 | 2 | ||||||
| MIRT564283 | ASB1 | ankyrin repeat and SOCS box containing 1 | |
|
2 | 2 | ||||||
| MIRT564350 | USP22 | ubiquitin specific peptidase 22 | |
|
2 | 2 | ||||||
| MIRT565279 | TNFRSF21 | TNF receptor superfamily member 21 | |
|
2 | 2 | ||||||
| MIRT565338 | TMEM104 | transmembrane protein 104 | |
|
2 | 2 | ||||||
| MIRT565905 | SCAMP2 | secretory carrier membrane protein 2 | |
|
2 | 2 | ||||||
| MIRT567108 | ITGB1 | integrin subunit beta 1 | |
|
2 | 2 | ||||||
| MIRT567601 | FANCF | Fanconi anemia complementation group F | |
|
2 | 2 | ||||||
| MIRT567779 | DGAT2 | diacylglycerol O-acyltransferase 2 | |
|
2 | 2 | ||||||
| MIRT568075 | CENPQ | centromere protein Q | |
|
2 | 2 | ||||||
| MIRT624304 | COL12A1 | collagen type XII alpha 1 chain | |
|
2 | 2 | ||||||
| MIRT644395 | CDKL1 | cyclin dependent kinase like 1 | |
|
2 | 2 | ||||||
| MIRT661547 | ZNF674 | zinc finger protein 674 | |
|
2 | 4 | ||||||
| MIRT670949 | IRAK3 | interleukin 1 receptor associated kinase 3 | |
|
2 | 2 | ||||||
| MIRT672951 | AKAP5 | A-kinase anchoring protein 5 | |
|
2 | 2 | ||||||
| MIRT697426 | ZFP36 | ZFP36 ring finger protein | |
|
2 | 2 | ||||||
| MIRT700793 | PIAS2 | protein inhibitor of activated STAT 2 | |
|
2 | 2 | ||||||
| MIRT702657 | ITGA3 | integrin subunit alpha 3 | |
|
2 | 2 | ||||||
| MIRT708945 | FZR1 | fizzy and cell division cycle 20 related 1 | |
|
2 | 2 | ||||||
| MIRT713657 | PLCE1 | phospholipase C epsilon 1 | |
|
2 | 2 | ||||||
| MIRT719239 | CYSLTR2 | cysteinyl leukotriene receptor 2 | |
|
2 | 2 | ||||||
| MIRT719951 | BLOC1S6 | biogenesis of lysosomal organelles complex 1 subunit 6 | |
|
2 | 2 | ||||||
| MIRT722048 | HLA-E | major histocompatibility complex, class I, E | |
|
2 | 2 | ||||||
| MIRT722201 | URM1 | ubiquitin related modifier 1 | |
|
2 | 2 | ||||||
| MIRT724790 | C1D | C1D nuclear receptor corepressor | |
|
2 | 2 | ||||||
| MIRT734347 | CYP2B6 | cytochrome P450 family 2 subfamily B member 6 | |
|
|
3 | 0 | |||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|