pre-miRNA Information
pre-miRNA hsa-mir-379   
Genomic Coordinates chr14: 101022066 - 101022132
Synonyms MIRN379, hsa-mir-379, MIR379
Description Homo sapiens miR-379 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-379-5p
Sequence 6| UGGUAGACUAUGGAACGUAGG |26
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101022075 16594986, 18684997, 21912681, 22499667, 24964909, 25692236, 26449202, 27229138, 28411194, 28550310, 29267965, 20591823, 27587585, 30022565, 29976955, 31682236, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1316049475 1 dbSNP
rs775428399 3 dbSNP
rs61991156 7 dbSNP
rs748621194 16 dbSNP
rs72631818 17 dbSNP
rs750490770 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CSRP2   
Synonyms CRP2, LMO5, SmLIM
Description cysteine and glycine rich protein 2
Transcript NM_001321   
Expression
Putative miRNA Targets on CSRP2
3'UTR of CSRP2
(miRNA target sites are highlighted)
>CSRP2|NM_001321|3'UTR
   1 GATGTAAACCCTGAACTAAACATCACACACTGAGAATCTCTTCATAATCTAGGCACAGATAATCTTTAACACTAAACTAC
  81 TGTGAAATTCTACCAGCATTAAGTACTGTATATCGCCCTGTACTTGGATAGGCTGGCTAACTCGTAGGAAGAGAGCACTG
 161 TATGGTATCCTTTTGCTTTATTCACCAGCATTTTGGGGGAACATTTCTTTTACATTTTAAATAAAACTTCAGCTTGAAAA
 241 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ggAUGCAAGGUAUCAGAUGGu 5'
            ||| | : | | |||||| 
Target 5' acTAC-TGTGAAATTCTACCa 3'
76 - 95 122.00 -13.30
2
miRNA  3' ggaugcaAGGUAUCAGAUggu 5'
                 |:|||| ||||   
Target 5' gaatctcTTCATAATCTAggc 3'
34 - 54 94.00 -5.30
3
miRNA  3' ggaUGCAAGGUAU--CAGAUGGU- 5'
             :| ||  :||  || ||:|: 
Target 5' ccaGCATTAAGTACTGTATATCGC 3'
93 - 116 92.00 -6.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30115284 23 COSMIC
COSN30508507 40 COSMIC
COSN20084762 54 COSMIC
COSN5953468 100 COSMIC
COSN30164309 111 COSMIC
COSN30102240 114 COSMIC
COSN30140505 115 COSMIC
COSN31594324 158 COSMIC
COSN31598849 165 COSMIC
COSN29570420 217 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs368010022 3 dbSNP
rs1349071978 10 dbSNP
rs1222863148 27 dbSNP
rs374115487 30 dbSNP
rs763163739 31 dbSNP
rs1158192174 37 dbSNP
rs779872583 37 dbSNP
rs758633496 40 dbSNP
rs370355440 43 dbSNP
rs376276002 46 dbSNP
rs753252360 47 dbSNP
rs772194805 48 dbSNP
rs1161270550 49 dbSNP
rs1246802752 50 dbSNP
rs957087734 54 dbSNP
rs925697608 61 dbSNP
rs1236789727 64 dbSNP
rs1200881528 78 dbSNP
rs1466455934 81 dbSNP
rs548051805 96 dbSNP
rs1318993500 98 dbSNP
rs1394516877 107 dbSNP
rs977052895 110 dbSNP
rs73391838 112 dbSNP
rs1227050551 114 dbSNP
rs190992421 114 dbSNP
rs1358570106 115 dbSNP
rs1320004750 120 dbSNP
rs1024013024 125 dbSNP
rs997664673 129 dbSNP
rs1336983761 132 dbSNP
rs958679371 133 dbSNP
rs1419003201 139 dbSNP
rs1196724772 143 dbSNP
rs902092094 144 dbSNP
rs994631839 145 dbSNP
rs1192861988 151 dbSNP
rs1371733041 153 dbSNP
rs1041988048 157 dbSNP
rs1333567832 159 dbSNP
rs1164028482 161 dbSNP
rs946068541 165 dbSNP
rs1422821191 173 dbSNP
rs1448746193 174 dbSNP
rs914521567 192 dbSNP
rs1054467298 196 dbSNP
rs937391991 199 dbSNP
rs374481893 201 dbSNP
rs775566606 207 dbSNP
rs927377865 212 dbSNP
rs1403529022 218 dbSNP
rs1382728799 231 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 1466.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ggAUGCAAGGUAUCAGAUGGu 5'
            ||| | : | | |||||| 
Target 5' acUAC-UGUGAAAUUCUACCa 3'
18 - 37
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000311083.5 | 3UTR | AUAAUCUUUAACACUAAACUACUGUGAAAUUCUACCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000311083.5 | 3UTR | AUAAUCUUUAACACUAAACUACUGUGAAAUUCUACCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000311083.5 | 3UTR | AUAAUCUUUAACACUAAACUACUGUGAAAUUCUACCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.486 2.3e-5 -0.577 3.0e-7 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.732 3.6e-5 -0.541 3.8e-3 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.585 1.1e-3 0.672 1.2e-4 25 Click to see details
GSE17306 Multiple myeloma 0.392 2.7e-3 0.374 4.1e-3 49 Click to see details
GSE19783 ER+ ER+ breast cancer 0.553 5.7e-3 0.325 8.1e-2 20 Click to see details
GSE19536 Breast cancer 0.244 7.2e-3 0.197 2.5e-2 100 Click to see details
GSE19350 CNS germ cell tumors 0.654 1.1e-2 0.741 2.9e-3 12 Click to see details
GSE38226 Liver fibrosis 0.481 1.4e-2 0.400 3.6e-2 21 Click to see details
GSE28544 Breast cancer 0.418 2.1e-2 0.392 2.9e-2 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.996 2.8e-2 1.000 5.0e-1 3 Click to see details
GSE28260 Renal cortex and medulla -0.502 4.0e-2 -0.621 1.2e-2 13 Click to see details
GSE14794 Lymphoblastoid cells 0.164 6.1e-2 0.160 6.6e-2 90 Click to see details
GSE32688 Pancreatic cancer 0.185 1.6e-1 0.056 3.8e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.233 1.6e-1 0.060 4.0e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.189 1.8e-1 0.042 4.2e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.232 1.9e-1 0.124 3.2e-1 16 Click to see details
GSE19783 ER- ER- breast cancer 0.098 2.0e-1 0.110 1.7e-1 79 Click to see details
GSE21032 Prostate cancer -0.09 2.1e-1 -0.035 3.8e-1 83 Click to see details
GSE21849 B cell lymphoma 0.153 2.1e-1 0.514 2.2e-3 29 Click to see details
GSE17498 Multiple myeloma -0.014 4.7e-1 -0.124 2.2e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.006 4.9e-1 -0.228 1.4e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
COAD -0.802 0.01 -0.357 0.19 8 Click to see details
KIRP 0.341 0.03 0.337 0.03 32 Click to see details
UCEC -0.439 0.03 -0.384 0.05 19 Click to see details
KIRC -0.185 0.07 -0.194 0.06 68 Click to see details
PCPG -0.948 0.1 -1.000 0.5 3 Click to see details
LUAD -0.368 0.12 -0.448 0.07 12 Click to see details
BRCA -0.112 0.16 -0.081 0.23 84 Click to see details
STAD 0.162 0.19 0.221 0.11 32 Click to see details
PAAD 0.579 0.21 0.400 0.3 4 Click to see details
THCA 0.104 0.22 0.114 0.19 59 Click to see details
HNSC -0.115 0.23 -0.115 0.23 42 Click to see details
PRAD 0.098 0.25 0.050 0.37 50 Click to see details
CESC -0.685 0.26 -1.000 0.5 3 Click to see details
ESCA 0.197 0.28 0.082 0.41 11 Click to see details
KICH -0.081 0.35 0.059 0.39 25 Click to see details
LUSC 0.054 0.37 -0.006 0.49 38 Click to see details
CHOL 0.102 0.4 0.150 0.35 9 Click to see details
LIHC -0.034 0.41 0.004 0.49 49 Click to see details
BLCA -0.008 0.49 0.009 0.49 18 Click to see details
BLCA -0.008 0.49 0.009 0.49 18 Click to see details
BLCA -0.008 0.49 0.009 0.49 18 Click to see details
70 hsa-miR-379-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007025 IL11 interleukin 11 1 1
MIRT068534 NHLRC3 NHL repeat containing 3 2 6
MIRT094166 PCGF3 polycomb group ring finger 3 2 6
MIRT100098 ABT1 activator of basal transcription 1 2 8
MIRT120926 PDE12 phosphodiesterase 12 2 8
MIRT179051 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT202043 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT215726 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT254608 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT266219 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT297447 SLC20A1 solute carrier family 20 member 1 2 4
MIRT315444 SLC16A10 solute carrier family 16 member 10 2 2
MIRT442137 C3orf17 nucleolus and neural progenitor protein 2 2
MIRT453878 IFRD1 interferon related developmental regulator 1 2 12
MIRT456258 TDRKH tudor and KH domain containing 2 12
MIRT456412 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT459729 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT461474 METTL1 methyltransferase like 1 2 2
MIRT463791 YBX1 Y-box binding protein 1 2 6
MIRT464031 WASL Wiskott-Aldrich syndrome like 2 2
MIRT464206 VGLL4 vestigial like family member 4 2 2
MIRT466712 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT467957 SLC16A1 solute carrier family 16 member 1 2 4
MIRT469224 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT473958 LRRC58 leucine rich repeat containing 58 2 2
MIRT475309 IFNLR1 interferon lambda receptor 1 2 2
MIRT476945 FAM83G family with sequence similarity 83 member G 2 4
MIRT477747 EDN1 endothelin 1 2 2
MIRT478260 DDX19B DEAD-box helicase 19B 2 2
MIRT478680 CSRP2 cysteine and glycine rich protein 2 2 4
MIRT490255 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT493289 LNPEP leucyl and cystinyl aminopeptidase 2 2
MIRT493564 HSPA5 heat shock protein family A (Hsp70) member 5 2 2
MIRT495960 TBC1D19 TBC1 domain family member 19 2 2
MIRT497106 BEST3 bestrophin 3 2 2
MIRT498348 CISD1 CDGSH iron sulfur domain 1 2 2
MIRT500783 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 8
MIRT501091 SLC5A6 solute carrier family 5 member 6 2 4
MIRT505309 TPD52 tumor protein D52 2 2
MIRT511107 NFIB nuclear factor I B 2 4
MIRT512737 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT514269 ZNF519 zinc finger protein 519 2 2
MIRT514602 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT515378 RPL7 ribosomal protein L7 2 2
MIRT518564 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT520459 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT529765 SF3B1 splicing factor 3b subunit 1 2 2
MIRT538005 DNAL1 dynein axonemal light chain 1 2 2
MIRT538250 CUL3 cullin 3 2 4
MIRT543777 RBM12B RNA binding motif protein 12B 2 4
MIRT546203 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT547201 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT548440 ELMOD2 ELMO domain containing 2 2 2
MIRT551634 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT553334 TSC22D2 TSC22 domain family member 2 2 2
MIRT556169 MCC mutated in colorectal cancers 2 2
MIRT557968 FAM222B family with sequence similarity 222 member B 2 2
MIRT560021 TM2D2 TM2 domain containing 2 2 2
MIRT560716 ZNF749 zinc finger protein 749 2 2
MIRT564114 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT564374 MRPS18B mitochondrial ribosomal protein S18B 2 2
MIRT566935 LIN28B lin-28 homolog B 5 2
MIRT573340 TUBD1 tubulin delta 1 2 2
MIRT607186 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT698515 TGFBR1 transforming growth factor beta receptor 1 2 2
MIRT704039 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT714582 PRRC1 proline rich coiled-coil 1 2 2
MIRT732163 PTK2 protein tyrosine kinase 2 3 1
MIRT732827 LINC00665 long intergenic non-protein coding RNA 665 3 0
MIRT735832 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-379 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-379 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
miR-379 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-379 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-379 Rifampicin approved 5381226 TaqMan low-density array hepatocellular carcinoma HepG2 cells 21540293 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 resistant
hsa-miR-379-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-379-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-379-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-379-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 resistant
hsa-miR-379-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-379-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-379-5p (3e)-3-[(6-methylimidazo[2,1-b]thiazol-5-yl)methylene]-1,3-dihydro-2h-indol-2-one 10755270 NSC726902 resistant
hsa-miR-379-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-379-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-379-5p (4-chlorophenyl) 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxylate 24204990 NSC733906 sensitive
hsa-miR-379-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-379-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-379-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-379-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-379-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-379-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-379-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-379-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-379-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-379-5p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 resistant
hsa-miR-379-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-379-5p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 sensitive
hsa-miR-379-5p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 resistant
hsa-miR-379-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-379-5p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 resistant
hsa-miR-379-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-379-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-379-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-379-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 386296 NSC678057 sensitive
hsa-miR-379-5p [4-[(4-bromophenyl)carbamothioyl]phenyl] n-(4-chlorophenyl)carbamate 5471250 NSC710003 resistant
hsa-miR-379-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-379-5p [5-[[2-chloroethyl(nitroso)carbamoyl]amino]-3-hydroxy-2-(hydroxymethyl)-6-methoxyoxan-4-yl] tetradecanoate 370169 NSC642913 sensitive
hsa-miR-379-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-379-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-379-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-379-5p 1-[(4-bromophenyl)amino]cyclopentanecarbonitrile 238637 NSC43101 resistant
hsa-miR-379-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 resistant
hsa-miR-379-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-379-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methylphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155808269 NSC762557 sensitive
hsa-miR-379-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-379-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-379-5p 1-cyclopentyl-3-[(Z)-1-pyridin-2-ylethylideneamino]thiourea 5468465 NSC670783 resistant
hsa-miR-379-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-379-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-379-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-379-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-379-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-379-5p 2-(2-(dimethylamino)ethylamino)naphthazarin 376950 NSC658145 resistant
hsa-miR-379-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-379-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-379-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-379-5p 2-[[4-[methyl-[(2,4,7-triaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid 387951 NSC682306 resistant
hsa-miR-379-5p 2-[2-(aziridin-1-yl)ethoxy]quinoline 268715 NSC109084 resistant
hsa-miR-379-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-379-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-379-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-379-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-379-5p 2-hydroxy discorhabdin d 362391 NSC626161 resistant
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-379-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-379-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-379-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-379-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-379-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-379-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-379-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-379-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-379-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-379-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-379-5p 3-[(e)-1-(2-hydroxy-4-methoxy-phenyl)ethylideneamino]-1,1-dimethyl-thiourea 135493996 NSC689547 resistant
hsa-miR-379-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 resistant
hsa-miR-379-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-379-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-379-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-379-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-379-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-379-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-379-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-379-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-379-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-379-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-379-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-379-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-379-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-379-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-379-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-379-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-379-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-379-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-379-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-379-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-379-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-379-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 resistant
hsa-miR-379-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-379-5p 5-methoxy-17-nitroso-8,9,10,12-tetrazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(17),2(7),3,5,8,11(16),12,14-octaene 54613484 NSC749292 resistant
hsa-miR-379-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-379-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-379-5p 5,10-dihydroxy-1-(4-piperidin-1-ylbutyl)naphtho[2,3-f]indole-4,11-dione 406505 NSC724632 resistant
hsa-miR-379-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-379-5p 5,11-dimethyl-2-[(pentanoyloxy)methyl]-6h-pyrido[4,3-b]carbazol-2-ium iodide 367409 NSC637130 sensitive
hsa-miR-379-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-379-5p 5.alpha.,25d-spirostan-3.beta.-ol glycoside NSC106557 sensitive
hsa-miR-379-5p 6-(2-(3-chlorophenyl)hydrazino)-2,4-pyrimidinediol 385879 NSC677279 resistant
hsa-miR-379-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-379-5p 6-[2-(dimethylamino)ethyl]-13-(2-isothiocyanatoethyl)-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 57327694 NSC757982 resistant
hsa-miR-379-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-379-5p 6-amino-5-[(4-fluorophenyl)methyl]-7-(1-methylbenzimidazol-2-yl)pyrrolo[2,3-b]pyrazine-2,3-dicarbonitrile 1179229 NSC730035 resistant
hsa-miR-379-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-379-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-379-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-379-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-379-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-379-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-379-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-379-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-379-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-379-5p 8-azainosine 135443893 NSC130279 resistant
hsa-miR-379-5p 8-chloro-7-methyl-5,5-dioxo-n-phenyl-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400657 NSC713019 sensitive
hsa-miR-379-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-379-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-379-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-379-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-379-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-379-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-379-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-379-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-379-5p Ak136303 388306 NSC682996 resistant
hsa-miR-379-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-379-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-379-5p Ao-267/15176074 393944 NSC696916 resistant
hsa-miR-379-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-379-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-379-5p Bis(2-nitrophenyl)sulfilimine 371591 NSC645984 resistant
hsa-miR-379-5p Carboplatin 38904 NSC241240 approved sensitive
hsa-miR-379-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-379-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-379-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-379-5p Crotonosid 223996 NSC12161 resistant
hsa-miR-379-5p Destruxin b NSC236580 resistant
hsa-miR-379-5p Dezaguanine 55710 NSC261726 resistant
hsa-miR-379-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-379-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-379-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-379-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-379-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-379-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-379-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-379-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-379-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-379-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-379-5p Gw701427a 10276395 NSC756323 sensitive
hsa-miR-379-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-379-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-379-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-379-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-379-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-379-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-379-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-379-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-379-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-379-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-379-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-379-5p Ls-94160 135408599 NSC52426 resistant
hsa-miR-379-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-379-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-379-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-379-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-379-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-379-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-379-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-379-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-379-5p Musennin 267361 NSC106554 sensitive
hsa-miR-379-5p N'-(cyano(4-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375017 NSC653843 sensitive
hsa-miR-379-5p N'-chloro-4-[2-[2-[4-[(Z)-N'-chlorocarbamimidoyl]phenoxy]ethyl-(4-methylphenyl)sulfonylamino]ethoxy]benzenecarboximidamide 45028721 NSC743909 sensitive
hsa-miR-379-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-379-5p N-(4-methylphenyl)-3-[3-(4-methylphenyl)imino-2-phenylinden-1-yl]sulfanyl-2-phenylinden-1-imine 389841 NSC686473 sensitive
hsa-miR-379-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-379-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 resistant
hsa-miR-379-5p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-379-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 resistant
hsa-miR-379-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-379-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-379-5p N-[2-(dimethylamino)ethyl]-4-(furo[3,2-c]quinolin-4-ylamino)benzamide 24204686 NSC732490 resistant
hsa-miR-379-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-379-5p N-[3-[(z)-n-methoxy-c-methylcarbonimidoyl]phenyl]-11h-indolo[3,2-c]quinolin-6-amine 9572585 NSC721041 resistant
hsa-miR-379-5p N-[dimethoxyphosphoryl(furan-2-yl)methyl]-4-[[4-[[dimethoxyphosphoryl(furan-2-yl)methyl]amino]phenyl]methyl]aniline 399251 NSC709928 sensitive
hsa-miR-379-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-379-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-379-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-379-5p Naphtho[2,1-b]quinolizinium, 7-methyl- chloride 5351151 NSC28002 sensitive
hsa-miR-379-5p Nigericin 34230 NSC292567 sensitive
hsa-miR-379-5p NSC372474 NSC372474 resistant
hsa-miR-379-5p NSC631451 NSC631451 resistant
hsa-miR-379-5p NSC751830 NSC751830 resistant
hsa-miR-379-5p NSC755523 NSC755523 resistant
hsa-miR-379-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-379-5p Paucin 282787 NSC136722 resistant
hsa-miR-379-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-379-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-379-5p Phosphinic acid, bis(1-aziridinyl)-, 2-naphthyl ester NSC55720 sensitive
hsa-miR-379-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-379-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-379-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-379-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-379-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-379-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-379-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-379-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-379-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-379-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-379-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-379-5p Stk134301 135400303 NSC715186 resistant
hsa-miR-379-5p Stl298328 387753 NSC681782 resistant
hsa-miR-379-5p Stl323102 375895 NSC656208 resistant
hsa-miR-379-5p Stl361983 256661 NSC83715 resistant
hsa-miR-379-5p Stl434863 394348 NSC697730 resistant
hsa-miR-379-5p Suavedol 65631 NSC141545 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-379-5p Thiosangivamycin 3006170 NSC105827 resistant
hsa-miR-379-5p Timtec1_002753 404248 NSC720426 sensitive
hsa-miR-379-5p Tridecyl 5-[(Z)-[3-methoxy-5-(1H-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1H-pyrrole-3-carboxylate 136226144 NSC763730 resistant
hsa-miR-379-5p Trimethyl-[[2-oxo-3-[(trimethylazaniumyl)methyl]cyclohexyl]methyl]azanium;iodide 360569 NSC622700 resistant
hsa-miR-379-5p Varacin trifluoroacetate salt 54611558 NSC722218 resistant
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved resistant
hsa-miR-379-5p Xestin a 5352066 NSC647638 resistant
hsa-miR-379-5p Xk-469 148183 NSC656889 sensitive
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved sensitive Low Malignant Pleural Mesothelioma cell line (MESO1)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-379-5p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Fluorouracil 3385 NSC19893 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-379-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-379-5p Ruxolitinib 25126798 NSC763371 approved resistant Low Myelofibrosis tissue
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, KU812)
hsa-miR-379-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (HCT116)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-379-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-379-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission