>CRTC2|NM_181715|3'UTR
   1 GGGCACCTCATCACCATCCCTCTTCTTGGCCCCATCCCCCACCACCATTCCTTTCCTCCCTTCCCCCTGGCAGGTAGAGA
  81 CTCTACTCTCTGTCCCCAGATCCTCTTTCTAGCATGAATGAAGGATGCCAAGAATGAGAAAAAGCAAGGGGTTTGTCCAG
 161 GTGGCCCCTGAATTCTGCGCAAGGGATGGGCCTGGGGGAACTCAAGGGAGGGCCTAAAGCACTTGTAACTTTGAACCGTC
 241 TGTCTGGAGGTCAGAGCCTGTTGGAAAGCAGGGGTAGAGGGGAGCCCTGGAAGCAGGGCTTTTCCGGATGCCTAGGGGTG
 321 GGCAGTGCCAGCCCCTCCTCACCACTCTTCCCCTTGCAGTGGAGGAGAGAGCCAGAGTGGATACTATTTTTTATTAAATA
 401 TATTATTATATGTTAATAAAAAAATCATATCAAACCCAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugaaAGGGAAGUCUCGGACCGa 5' ||||||| |||||| Target 5' ttccTCCCTTCCC--CCTGGCa 3'	53 - 72	133.00	-19.30
2	miRNA 3' ugaaagggaaguCUCGGACCga 5' |:|||||| Target 5' tgcgcaagggatGGGCCTGGgg 3'	176 - 197	126.00	-12.90
3	miRNA 3' ugaaagggaAGUCUCGGACcga 5' |||||||||| Target 5' gtctggaggTCAGAGCCTGttg 3'	242 - 263	125.00	-16.82

Mutant ID	Mutant Position	Mutant Source
COSN30156870	12	COSMIC
COSN20073416	13	COSMIC
COSN15314472	21	COSMIC
COSN30142710	48	COSMIC
COSN18724858	63	COSMIC
COSN31531877	165	COSMIC
COSN1089702	224	COSMIC
COSN31484382	260	COSMIC
COSN23851183	306	COSMIC
COSN26679377	345	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1335652576	4	dbSNP
rs1409023830	6	dbSNP
rs1033331886	12	dbSNP
rs369997824	14	dbSNP
rs755717671	20	dbSNP
rs10559	21	dbSNP
rs771811181	24	dbSNP
rs767292512	25	dbSNP
rs1362591860	26	dbSNP
rs754614677	29	dbSNP
rs751224631	36	dbSNP
rs766147538	38	dbSNP
rs762789743	43	dbSNP
rs1045967433	45	dbSNP
rs377179162	46	dbSNP
rs760753667	47	dbSNP
rs1167473363	54	dbSNP
rs1395641922	55	dbSNP
rs1415016826	59	dbSNP
rs561719140	79	dbSNP
rs1359407022	85	dbSNP
rs1413944437	97	dbSNP
rs879219938	99	dbSNP
rs571177423	102	dbSNP
rs1224575741	106	dbSNP
rs1250318793	114	dbSNP
rs934992802	118	dbSNP
rs1345139034	124	dbSNP
rs543562633	128	dbSNP
rs1415136559	137	dbSNP
rs1030476295	150	dbSNP
rs925040756	151	dbSNP
rs979173512	155	dbSNP
rs1217884944	169	dbSNP
rs942534244	178	dbSNP
rs576072816	179	dbSNP
rs1378221481	182	dbSNP
rs1479065621	204	dbSNP
rs1175364249	210	dbSNP
rs1373572083	219	dbSNP
rs1433851286	225	dbSNP
rs780768791	226	dbSNP
rs986628820	229	dbSNP
rs564104982	233	dbSNP
rs942063934	237	dbSNP
rs545681447	238	dbSNP
rs769440799	247	dbSNP
rs887777658	254	dbSNP
rs1234803335	257	dbSNP
rs1301865863	271	dbSNP
rs1428205740	272	dbSNP
rs1417613635	273	dbSNP
rs578217139	284	dbSNP
rs1241286110	294	dbSNP
rs1047812479	297	dbSNP
rs8450	299	dbSNP
rs1204733021	301	dbSNP
rs1268322824	303	dbSNP
rs866788240	305	dbSNP
rs962715227	306	dbSNP
rs1191889476	312	dbSNP
rs1017443166	322	dbSNP
rs1001588165	333	dbSNP
rs1393160342	341	dbSNP
rs1453775772	343	dbSNP
rs992426700	348	dbSNP
rs1365286031	353	dbSNP
rs937931325	357	dbSNP
rs866473467	360	dbSNP
rs534860862	369	dbSNP
rs1209357488	380	dbSNP
rs1481902064	381	dbSNP
rs979117990	386	dbSNP
rs41312716	393	dbSNP
rs892072398	400	dbSNP
rs555409369	402	dbSNP
rs913582711	407	dbSNP
rs1053274722	412	dbSNP
rs1294778174	413	dbSNP
rs987826225	418	dbSNP
rs1211873460	425	dbSNP
rs548651195	425	dbSNP
rs1458297266	427	dbSNP
rs1233467630	428	dbSNP
rs1354597353	429	dbSNP
rs1310779126	435	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.