>CKS2|NM_001827|3'UTR
   1 AGTTTATCTGGGGATCGTCAAATCTTTTTCAAATTTAATGTATATGTGTATATAAGGTAGTATTCAGTGAATACTTGAGA
  81 AATGTACAAATCTTTCATCCATACCTGTGCATGAGCTGTATTCTTCACAGCAACAGAGCTCAGTTAAATGCAACTGCAAG
 161 TAGGTTACTGTAAGATGTTTAAGATAAAAGTTCTTCCAGTCAGTTTTTCTCTTAAGTGCCTGTTTGAGTTTACTGAAACA
 241 GTTTACTTTTGTTCAATAAAGTTTGTATGTTGCATTTAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ggACGAGGUUU---UUAGGUAa 5' | :|:|||| ||| :|| Target 5' tcTTTTTCAAATTTAATGTATa 3'	23 - 44	109.00	-5.30
2	miRNA 3' ggaCGAGGUU--UUUAGGUaa 5' ||| ||: |||| || Target 5' agaGCT-CAGTTAAATGCAac 3'	135 - 154	101.00	-7.10
3	miRNA 3' ggACGAGGU-UUUUAGGUAa 5' ||:|| | |||:|:::| Target 5' ttTGTTCAATAAAGTTTGTa 3'	248 - 267	101.00	-7.20

Mutant ID	Mutant Position	Mutant Source
COSN30459598	3	COSMIC
COSN31599151	30	COSMIC
COSN31577965	47	COSMIC
COSN31594481	74	COSMIC
COSN30146426	78	COSMIC
COSN30119530	87	COSMIC
COSN14720204	94	COSMIC
COSN2332826	183	COSMIC
COSN30136344	265	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs778251129	3	dbSNP
rs1388138143	6	dbSNP
rs753959563	10	dbSNP
rs1489811494	13	dbSNP
rs1168255999	15	dbSNP
rs989608739	17	dbSNP
rs898090936	18	dbSNP
rs541536420	22	dbSNP
rs778794322	23	dbSNP
rs947673556	25	dbSNP
rs561735864	33	dbSNP
rs772339833	35	dbSNP
rs1235521027	36	dbSNP
rs781240509	41	dbSNP
rs1282948457	42	dbSNP
rs1307596621	43	dbSNP
rs907500649	46	dbSNP
rs1228120499	52	dbSNP
rs938924597	57	dbSNP
rs1348391300	70	dbSNP
rs1206424811	74	dbSNP
rs188051442	76	dbSNP
rs1441550587	78	dbSNP
rs1201405526	82	dbSNP
rs1383440652	86	dbSNP
rs886583945	88	dbSNP
rs547378527	91	dbSNP
rs14867	94	dbSNP
rs1035120980	97	dbSNP
rs896453508	105	dbSNP
rs1374533357	106	dbSNP
rs11548885	117	dbSNP
rs1193647915	130	dbSNP
rs1184541682	136	dbSNP
rs1259656128	154	dbSNP
rs533076595	157	dbSNP
rs996613130	173	dbSNP
rs1262719971	174	dbSNP
rs3211693	176	dbSNP
rs1320306496	178	dbSNP
rs1160435708	180	dbSNP
rs1271080320	181	dbSNP
rs1227239811	196	dbSNP
rs1325182481	197	dbSNP
rs1336769679	198	dbSNP
rs567037449	199	dbSNP
rs967296875	200	dbSNP
rs1406125152	207	dbSNP
rs569735882	215	dbSNP
rs1000015045	221	dbSNP
rs1467849525	223	dbSNP
rs1421210600	226	dbSNP
rs1168278722	229	dbSNP
rs954631578	233	dbSNP
rs1474995156	236	dbSNP
rs1469303593	238	dbSNP
rs1334968917	240	dbSNP
rs764770923	244	dbSNP
rs369560756	245	dbSNP
rs1030849539	246	dbSNP
rs1439770934	255	dbSNP
rs958079892	257	dbSNP
rs1286354560	260	dbSNP
rs989249892	269	dbSNP
rs752109011	274	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.