miRTarBase - #MIRT480159


—
pre-miRNA Information
pre-miRNA hsa-mir-4749   
Genomic Coordinates chr19: 49854591 - 49854651
Description Homo sapiens miR-4749 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4749-5p
Sequence 3| UGCGGGGACAGGCCAGGGCAUC |24
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN13820895 3 COSMIC
COSN23388686 4 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs770355657 2 dbSNP
rs370929811 3 dbSNP
rs552910419 4 dbSNP
rs766523467 7 dbSNP
rs751761421 13 dbSNP
rs759326327 15 dbSNP
rs747312801 19 dbSNP
rs1336524397 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CALR   
Synonyms CRT, HEL-S-99n, RO, SSA, cC1qR
Description calreticulin
Transcript NM_004343   
Expression
Putative miRNA Targets on CALR
3'UTR of CALR
(miRNA target sites are highlighted)		 
>CALR|NM_004343|3'UTR
   1 AGAGGCCTGCCTCCAGGGCTGGACTGAGGCCTGAGCGCTCCTGCCGCAGAGCTGGCCGCGCCAAATAATGTCTCTGTGAG
  81 ACTCGAGAACTTTCATTTTTTTCCAGGCTGGTTCGGATTTGGGGTGGATTTTGGTTTTGTTCCCCTCCTCCACTCTCCCC
 161 CACCCCCTCCCCGCCCTTTTTTTTTTTTTTTTTTAAACTGGTATTTTATCTTTGATTCTCCTTCAGCCCTCACCCCTGGT
 241 TCTCATCTTTCTTGATCAACATCTTTTCTTGCCTCTGTCCCCTTCTCTCATCTCTTAGCTCCCCTCCAACCTGGGGGGCA
 321 GTGGTGTGGAGAAGCCACAGGCCTGAGATTTCATCTGCTCTCCTTCCTGGAGCCCAGAGGAGGGCAGCAGAAGGGGGTGG
 401 TGTCTCCAACCCCCCAGCACTGAGGAAGAACGGGGCTCTTCTCATTTCACCCCTCCCTTTCTCCCCTGCCCCCAGGACTG
 481 GGCCACTTCTGGGTGGGGCAGTGGGTCCCAGATTGGCTCACACTGAGAATGTAAGAACTACAAACAAAATTTCTATTAAA
 561 TTAAATTTTGTGTCTCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuACGGGACCGGACAGGGGCGu 5'
            | |||   ||  ||||||| 
Target 5' tcTCCCCCACCCCCTCCCCGCc 3'
 154 - 175 152.00 -19.60
2 
miRNA  3' cuACGGGACCG-GACAGGGGcgu 5'
            | :|:|| | ||||||||   
Target 5' ctTTTCTTGCCTCTGTCCCCttc 3'
 263 - 285 128.00 -19.20
3 
miRNA  3' cuacGGGACC-GGAC-AGGGGCGu 5'
              :::||| ::|| ||||| | 
Target 5' tggaTTTTGGTTTTGTTCCCCTCc 3'
 125 - 148 122.00 -15.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31514627 19 COSMIC
COSN31594690 33 COSMIC
COSN5854005 37 COSMIC
COSN31553471 47 COSMIC
COSN8992555 55 COSMIC
COSN26647800 58 COSMIC
COSN22091146 60 COSMIC
COSN30502800 79 COSMIC
COSN28679469 86 COSMIC
COSN28829371 95 COSMIC
COSN8604996 124 COSMIC
COSN24338741 163 COSMIC
COSN17935320 174 COSMIC
COSN17464062 178 COSMIC
COSN29899859 194 COSMIC
COSN16961326 298 COSMIC
COSN24306515 373 COSMIC
COSN30164355 391 COSMIC
COSN30164400 403 COSMIC
COSN32071067 409 COSMIC
COSN31607930 568 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1247322866 9 dbSNP
rs1460617894 12 dbSNP
rs760106465 13 dbSNP
rs767866498 14 dbSNP
rs1267251811 15 dbSNP
rs1450552729 16 dbSNP
rs775958456 20 dbSNP
rs772125362 26 dbSNP
rs760999179 29 dbSNP
rs764355856 30 dbSNP
rs754052898 33 dbSNP
rs201689726 34 dbSNP
rs1433660965 35 dbSNP
rs376336055 37 dbSNP
rs200311949 38 dbSNP
rs1437027805 39 dbSNP
rs758391484 40 dbSNP
rs1240930726 41 dbSNP
rs914931625 41 dbSNP
rs966750434 42 dbSNP
rs370833569 46 dbSNP
rs746868119 47 dbSNP
rs773496319 48 dbSNP
rs1323639105 51 dbSNP
rs754808968 52 dbSNP
rs1049481 55 dbSNP
rs747808948 57 dbSNP
rs541056414 58 dbSNP
rs772804964 59 dbSNP
rs933859957 60 dbSNP
rs748710698 61 dbSNP
rs747059522 64 dbSNP
rs1415504615 68 dbSNP
rs1403101847 70 dbSNP
rs1163395143 71 dbSNP
rs1389319700 73 dbSNP
rs1458711352 75 dbSNP
rs775840772 77 dbSNP
rs957234183 81 dbSNP
rs534575328 85 dbSNP
rs530306492 86 dbSNP
rs771082692 89 dbSNP
rs764926857 94 dbSNP
rs542543565 95 dbSNP
rs1329902103 96 dbSNP
rs563838695 97 dbSNP
rs1250117096 104 dbSNP
rs1273248742 108 dbSNP
rs1438820941 110 dbSNP
rs1266772145 115 dbSNP
rs766399808 116 dbSNP
rs1063382 121 dbSNP
rs1210681003 127 dbSNP
rs1349971102 142 dbSNP
rs899195561 143 dbSNP
rs993890476 144 dbSNP
rs1297242212 146 dbSNP
rs1048048231 149 dbSNP
rs889025859 153 dbSNP
rs1174398898 155 dbSNP
rs922991878 156 dbSNP
rs1420460381 157 dbSNP
rs1428175930 157 dbSNP
rs929022688 161 dbSNP
rs1470919941 162 dbSNP
rs942065047 163 dbSNP
rs983229436 164 dbSNP
rs1210131806 165 dbSNP
rs1342232072 166 dbSNP
rs1224735788 168 dbSNP
rs1038092945 169 dbSNP
rs1313806208 172 dbSNP
rs1380150497 173 dbSNP
rs897921643 174 dbSNP
rs1063386 175 dbSNP
rs1063387 176 dbSNP
rs1491282901 176 dbSNP
rs1491487504 177 dbSNP
rs16978824 177 dbSNP
rs371347484 177 dbSNP
rs58546164 177 dbSNP
rs757949750 177 dbSNP
rs778124073 177 dbSNP
rs869239029 177 dbSNP
rs1063388 178 dbSNP
rs1329990200 179 dbSNP
rs1187081950 183 dbSNP
rs867583240 190 dbSNP
rs1438353381 195 dbSNP
rs1260706696 196 dbSNP
rs1326269692 199 dbSNP
rs1204920971 204 dbSNP
rs1260480122 209 dbSNP
rs1485119492 211 dbSNP
rs1188691161 214 dbSNP
rs531150807 216 dbSNP
rs1262633312 219 dbSNP
rs1480240969 221 dbSNP
rs1197282979 222 dbSNP
rs1234793137 223 dbSNP
rs1431628087 227 dbSNP
rs1293086924 230 dbSNP
rs906777358 237 dbSNP
rs552256480 239 dbSNP
rs1327501006 242 dbSNP
rs1390885601 261 dbSNP
rs1391592107 262 dbSNP
rs570573178 263 dbSNP
rs528232435 273 dbSNP
rs546277059 279 dbSNP
rs1470440481 286 dbSNP
rs1063415 288 dbSNP
rs1344357039 291 dbSNP
rs941578005 293 dbSNP
rs1038989760 296 dbSNP
rs1803237 297 dbSNP
rs191183059 298 dbSNP
rs1290422181 300 dbSNP
rs1010670003 303 dbSNP
rs948701815 304 dbSNP
rs1022444216 305 dbSNP
rs907240547 325 dbSNP
rs535373714 330 dbSNP
rs1278259910 333 dbSNP
rs977718991 338 dbSNP
rs1239015448 341 dbSNP
rs1331700232 343 dbSNP
rs1328039053 346 dbSNP
rs1438901496 347 dbSNP
rs1280789118 359 dbSNP
rs1346898447 361 dbSNP
rs1401073414 363 dbSNP
rs554157386 364 dbSNP
rs1156722555 367 dbSNP
rs1469585020 371 dbSNP
rs955292670 373 dbSNP
rs1452091043 375 dbSNP
rs1251984292 376 dbSNP
rs892929790 381 dbSNP
rs1401815150 382 dbSNP
rs1011415891 384 dbSNP
rs556183549 385 dbSNP
rs1282619532 389 dbSNP
rs757598551 393 dbSNP
rs11210 395 dbSNP
rs1232168004 398 dbSNP
rs1315684912 399 dbSNP
rs1218315592 410 dbSNP
rs1298569703 410 dbSNP
rs9978 411 dbSNP
rs976427385 413 dbSNP
rs1490247142 416 dbSNP
rs1315998052 419 dbSNP
rs539257085 429 dbSNP
rs950398308 431 dbSNP
rs1175513145 432 dbSNP
rs941176042 439 dbSNP
rs1394002518 443 dbSNP
rs1037815379 444 dbSNP
rs1186694036 449 dbSNP
rs35275976 450 dbSNP
rs1803236 451 dbSNP
rs920676195 453 dbSNP
rs929357838 456 dbSNP
rs1050279 462 dbSNP
rs35885654 463 dbSNP
rs1417240552 465 dbSNP
rs1283087042 472 dbSNP
rs1047769894 474 dbSNP
rs1209410380 478 dbSNP
rs1347216925 484 dbSNP
rs906495225 487 dbSNP
rs1380743599 488 dbSNP
rs1050434 490 dbSNP
rs1216509705 492 dbSNP
rs939603135 494 dbSNP
rs1269891520 498 dbSNP
rs1801594 500 dbSNP
rs1423578618 502 dbSNP
rs1355895493 512 dbSNP
rs15340 514 dbSNP
rs777711589 516 dbSNP
rs948982568 523 dbSNP
rs907209286 529 dbSNP
rs557569683 536 dbSNP
rs1411233799 540 dbSNP
rs765813963 542 dbSNP
rs1011488246 548 dbSNP
rs558061709 555 dbSNP
rs1436511469 556 dbSNP
rs1260116336 566 dbSNP
rs1475723526 566 dbSNP
rs1186367212 567 dbSNP
rs1485649555 572 dbSNP
rs1022079089 573 dbSNP
rs1206701468 577 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuACGGGACCGGACAGGGGCgu 5'
            | |||   ||  ||||||  
Target 5' ucUCCCCCACCCCCUCCCCG-- 3'
 		15 - 34
2 
miRNA  3' cuacgggaccggacAGGGGCGu 5'
                        ||||| | 
Target 5' -------------uUCCCCUCc 3'
 		1 - 9
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000316448.5 | 3UTR | UUCCCCUCCUCCACUCUCCCCCACCCCCUCCCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
54 hsa-miR-4749-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT062471 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT216687 F2R coagulation factor II thrombin receptor 2 2
MIRT452932 DISC1 disrupted in schizophrenia 1 2 2
MIRT457070 TOR4A torsin family 4 member A 2 2
MIRT464196 VGLL4 vestigial like family member 4 2 4
MIRT464974 TULP1 tubby like protein 1 2 6
MIRT471714 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT473152 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT476086 GRB2 growth factor receptor bound protein 2 2 2
MIRT477697 EFHD2 EF-hand domain family member D2 2 2
MIRT480159 CALR calreticulin 2 2
MIRT483732 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT484553 BARHL1 BarH like homeobox 1 2 6
MIRT485994 YIPF2 Yip1 domain family member 2 2 2
MIRT486530 CLCN7 chloride voltage-gated channel 7 2 2
MIRT487220 HIC1 HIC ZBTB transcriptional repressor 1 2 2
MIRT487799 GPR20 G protein-coupled receptor 20 2 4
MIRT487879 CASZ1 castor zinc finger 1 2 4
MIRT489682 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT489735 GNAI2 G protein subunit alpha i2 2 4
MIRT489754 TACC3 transforming acidic coiled-coil containing protein 3 2 2
MIRT489841 HCFC1 host cell factor C1 2 2
MIRT490386 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490584 SLC47A1 solute carrier family 47 member 1 2 2
MIRT490722 SLC9A3 solute carrier family 9 member A3 2 2
MIRT490741 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT491705 PDZD4 PDZ domain containing 4 2 2
MIRT491743 SEMA3F semaphorin 3F 2 2
MIRT492740 PER1 period circadian clock 1 2 10
MIRT493162 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT493414 KDM6B lysine demethylase 6B 2 2
MIRT493716 H2AFX H2A histone family member X 2 2
MIRT494628 ASB6 ankyrin repeat and SOCS box containing 6 2 4
MIRT494709 ARHGAP31 Rho GTPase activating protein 31 2 2
MIRT495753 PDE4C phosphodiesterase 4C 2 4
MIRT499605 ANKRD45 ankyrin repeat domain 45 2 2
MIRT501164 SLC10A7 solute carrier family 10 member 7 2 6
MIRT502116 KMT2D lysine methyltransferase 2D 2 2
MIRT502657 CTC1 CST telomere replication complex component 1 2 12
MIRT516766 FAM212B family with sequence similarity 212 member B 2 4
MIRT531190 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531975 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT569101 FSCN1 fascin actin-bundling protein 1 2 2
MIRT569315 CC2D1B coiled-coil and C2 domain containing 1B 2 2
MIRT569535 CTTN cortactin 2 2
MIRT569851 RGS5 regulator of G protein signaling 5 2 2
MIRT570594 NFIX nuclear factor I X 2 2
MIRT608759 CACNA1A calcium voltage-gated channel subunit alpha1 A 2 2
MIRT616276 HOXD11 homeobox D11 2 2
MIRT639725 RAB17 RAB17, member RAS oncogene family 2 2
MIRT661072 PAK4 p21 (RAC1) activated kinase 4 2 2
MIRT703496 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT712894 TGFA transforming growth factor alpha 2 2
MIRT721299 C3orf36 chromosome 3 open reading frame 36 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4749 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4749 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4749 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-miR-4749-5p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4749-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4749-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4749-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-4749-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-4749-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4749-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4749-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4749-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4749-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4749-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4749-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission