>CALM2|NM_001743|3'UTR
   1 AGACCTTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTCTTTGTTTGTAACTTATCTGTAAAA
  81 GGTTTCTCCCTACTGTCAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTATCTTAC
 161 TGTCATTGTCCTAAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCC
 241 CTTCTGCACATCTAAACTTAGATGGAGTTGGTCAAATGAGGGAACATCTGGGTTATGCCTTTTTTAAAGTAGTTTTCTTT
 321 AGGAACTGTCAGCATGTTGTTGTTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCAACAATATGTACTTAA
 401 AAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTGCTGGTCCTGTACCAGAAA
 481 CATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAATCTGCTTATGGCACAATTTGCCTCAAAAT
 561 CCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAATTACAATTTACCCAATGGTTGCTCTGCATCTGAGTCATTTAAC
 641 TGTTGAAGTCTAATAATTTTGAAAATAAAATATGGCATTGGTTTCTGCTTGGTAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' caUUCUUCACGAAU-GUAACGUc 5' || |: ||| | :|||||| Target 5' ttAAAAGTTGC--ACTATTGCAa 3'	397 - 417	136.00	-7.80
2	miRNA 3' caUUCUUCACGAAUGUAACGUc 5' || | |||| :|| ||| Target 5' ttAAAATCTGCT--TATGGCAc 3'	526 - 545	108.00	-5.90
3	miRNA 3' caUUCUUCACGAAUGUAACGuc 5' || || ||| |||| | Target 5' gtAATTAGGACTT-CATTCCtc 3'	117 - 137	103.00	-5.60

Mutant ID	Mutant Position	Mutant Source
COSN30131064	2	COSMIC
COSN26969044	8	COSMIC
COSN31523845	15	COSMIC
COSN31571975	28	COSMIC
COSN26643384	56	COSMIC
COSN20838319	58	COSMIC
COSN26969043	64	COSMIC
COSN1842128	67	COSMIC
COSN22883452	90	COSMIC
COSN22291816	102	COSMIC
COSN21637819	173	COSMIC
COSN21636633	197	COSMIC
COSN21636858	228	COSMIC
COSN22713149	242	COSMIC
COSN31577178	336	COSMIC
COSN21637599	356	COSMIC
COSN21636857	375	COSMIC
COSN22617058	427	COSMIC
COSN1842126	441	COSMIC
COSN31551566	449	COSMIC
COSN24299003	469	COSMIC
COSN15768605	573	COSMIC
COSN15772761	577	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs748745893	4	dbSNP
rs1156758234	7	dbSNP
rs531333199	11	dbSNP
rs762752486	13	dbSNP
rs368451986	22	dbSNP
rs1195681347	24	dbSNP
rs1292819964	30	dbSNP
rs764833006	33	dbSNP
rs375169069	34	dbSNP
rs1353536266	36	dbSNP
rs775969371	40	dbSNP
rs780196951	45	dbSNP
rs771855459	49	dbSNP
rs943889470	54	dbSNP
rs912422349	55	dbSNP
rs769849234	60	dbSNP
rs1363566374	63	dbSNP
rs1296176317	66	dbSNP
rs771811022	66	dbSNP
rs1326360861	68	dbSNP
rs1316920749	72	dbSNP
rs745695320	73	dbSNP
rs545773591	79	dbSNP
rs1347873770	88	dbSNP
rs1025394436	95	dbSNP
rs11551429	96	dbSNP
rs973736709	97	dbSNP
rs1262876031	100	dbSNP
rs1172595866	103	dbSNP
rs574525770	106	dbSNP
rs901994830	108	dbSNP
rs961083314	111	dbSNP
rs11551441	114	dbSNP
rs548616713	116	dbSNP
rs1172963170	122	dbSNP
rs1040965789	124	dbSNP
rs530457703	125	dbSNP
rs1475005968	127	dbSNP
rs1432538658	134	dbSNP
rs1159482053	141	dbSNP
rs1346778287	148	dbSNP
rs1002648553	149	dbSNP
rs879472016	150	dbSNP
rs11551430	153	dbSNP
rs1442461783	155	dbSNP
rs1323373946	160	dbSNP
rs1367443241	160	dbSNP
rs907350467	165	dbSNP
rs1309552862	192	dbSNP
rs1238842406	197	dbSNP
rs1023167191	203	dbSNP
rs559669117	214	dbSNP
rs1210376537	215	dbSNP
rs893390228	216	dbSNP
rs541269448	221	dbSNP
rs1220171879	224	dbSNP
rs1177739095	225	dbSNP
rs1339204819	226	dbSNP
rs1417054011	230	dbSNP
rs998823939	232	dbSNP
rs11551428	242	dbSNP
rs1268914249	243	dbSNP
rs903242208	248	dbSNP
rs185411626	254	dbSNP
rs1462701048	257	dbSNP
rs1402440642	258	dbSNP
rs1040842601	266	dbSNP
rs1348822614	280	dbSNP
rs944840309	281	dbSNP
rs1803206	282	dbSNP
rs1371857630	283	dbSNP
rs879396732	288	dbSNP
rs1803208	297	dbSNP
rs1294306965	306	dbSNP
rs909810069	309	dbSNP
rs1231720535	311	dbSNP
rs768275353	318	dbSNP
rs565042586	320	dbSNP
rs984074987	321	dbSNP
rs1206769427	323	dbSNP
rs1234531529	335	dbSNP
rs575041831	339	dbSNP
rs951016454	341	dbSNP
rs774217808	342	dbSNP
rs1257967750	345	dbSNP
rs1025341795	346	dbSNP
rs1803209	346	dbSNP
rs912378943	348	dbSNP
rs997925923	350	dbSNP
rs1410007980	366	dbSNP
rs146630528	367	dbSNP
rs1019082576	368	dbSNP
rs1169533279	375	dbSNP
rs932517589	384	dbSNP
rs919849831	392	dbSNP
rs1424354069	393	dbSNP
rs576376968	396	dbSNP
rs1413379719	407	dbSNP
rs1283789252	411	dbSNP
rs1803207	415	dbSNP
rs1187315456	417	dbSNP
rs973705705	420	dbSNP
rs961314876	423	dbSNP
rs1270985479	427	dbSNP
rs908229242	430	dbSNP
rs981590320	439	dbSNP
rs971209145	441	dbSNP
rs889326779	442	dbSNP
rs1437580413	445	dbSNP
rs1054633786	449	dbSNP
rs562996983	457	dbSNP
rs1187696213	463	dbSNP
rs1416812231	466	dbSNP
rs1023513541	469	dbSNP
rs562287437	471	dbSNP
rs1174789939	476	dbSNP
rs11551467	477	dbSNP
rs1013044680	482	dbSNP
rs9581	487	dbSNP
rs957587402	489	dbSNP
rs15176	492	dbSNP
rs193256689	499	dbSNP
rs144539242	511	dbSNP
rs1292066912	515	dbSNP
rs950142023	523	dbSNP
rs1230920272	532	dbSNP
rs768674199	532	dbSNP
rs1364571865	533	dbSNP
rs1235176616	543	dbSNP
rs1304027431	545	dbSNP
rs79550517	546	dbSNP
rs999088772	547	dbSNP
rs749206055	552	dbSNP
rs1303031863	553	dbSNP
rs1447177159	557	dbSNP
rs1217526027	560	dbSNP
rs1040411940	568	dbSNP
rs74959150	569	dbSNP
rs187511042	589	dbSNP
rs1049555769	591	dbSNP
rs1397419255	595	dbSNP
rs543893798	596	dbSNP
rs937152565	598	dbSNP
rs1466016195	601	dbSNP
rs1316459824	603	dbSNP
rs909749244	606	dbSNP
rs1393633086	607	dbSNP
rs541631852	612	dbSNP
rs1231018767	615	dbSNP
rs1474254694	615	dbSNP
rs1351101994	616	dbSNP
rs919818636	619	dbSNP
rs139812365	625	dbSNP
rs1182628322	629	dbSNP
rs1464208166	633	dbSNP
rs939986303	641	dbSNP
rs908201068	643	dbSNP
rs1254341439	659	dbSNP
rs116421442	662	dbSNP
rs1198801561	667	dbSNP
rs971518658	669	dbSNP
rs1468381478	672	dbSNP
rs556314561	673	dbSNP
rs976836709	673	dbSNP
rs1231479759	676	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.