pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4708 |
Genomic Coordinates | chr14: 65335117 - 65335183 |
Description | Homo sapiens miR-4708 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4708-5p | ||||||||||||
Sequence | 9| AGAGAUGCCGCCUUGCUCCUU |29 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Illumina | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | BBC3 | ||||||||||||||||||||
Synonyms | JFY-1, JFY1, PUMA | ||||||||||||||||||||
Description | BCL2 binding component 3 | ||||||||||||||||||||
Transcript | NM_001127241 | ||||||||||||||||||||
Other Transcripts | NM_001127240 , NM_001127242 , NM_014417 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on BBC3 | |||||||||||||||||||||
3'UTR of BBC3 (miRNA target sites are highlighted) |
>BBC3|NM_001127241|3'UTR 1 GTGCCTGCACCCGCCCGGTGGACGTCAGGGACTCGGGGGGCAGGCCCCTCCCACCTCCTGACACCCTGGCCAGCGCGGGG 81 GACTTTCTCTGCACCATGTAGCATACTGGACTCCCAGCCCTGCCTGTCCCGGGGGCGGGCCGGGGCAGCCACTCCAGCCC 161 CAGCCCAGCCTGGGGTGCACTGACGGAGATGCGGACTCCTGGGTCCCTGGCCAAGAAGCCAGGAGAGGGACGGCTGATGG 241 ACTCAGCATCGGAAGGTGGCGGTGACCGAGGGGGTGGGGACTGAGCCGCCCGCCTCTGCCGCCCACCACCATCTCAGGAA 321 AGGCTGTTGTGCTGGTGCCCGTTCCAGCTGCAGGGGTGACACTGGGGGGGGGGGGCTCTCCTCTCGGTGCTCCTTCACTC 401 TGGGCCTGGCCTCAGGCCCCTGGTGCTTCCCCCCCTCCTCCTGGGAGGGGGCCCGTGAAGAGCAAATGAGCCAAACGTGA 481 CCACTAGCCTCCTGGAGCCAGAGAGTGGGGCTCGTTTGCCGGTTGCTCCAGCCCGGCGCCCAGCCATCTTCCCTGAGCCA 561 GCCGGCGGGTGGTGGGCATGCCTGCCTCACCTTCATCAGGGGGTGGCCAGGAGGGGCCCAGACTGTGAATCCTGTGCTCT 641 GCCCGTGACCGCCCCCCGCCCCATCAATCCCATTGCATAGGTTTAGAGAGAGCACGTGTGACCACTGGCATTCATTTGGG 721 GGGTGGGAGATTTTGGCTGAAGCCGCCCCAGCCTTAGTCCCCAGGGCCAAGCGCTGGGGGGAAGACGGGGAGTCAGGGAG 801 GGGGGGAAATCTCGGAAGAGGGAGGAGTCTGGGAGTGGGGAGGGATGGCCCAGCCTGTAAGATACTGTATATGCGCTGCT 881 GTAGATACCGGAATGAATTTTCTGTACATGTTTGGTTAATTTTTTTTGTACATGATTTTTGTATGTTTCCTTTTCAATAA 961 AATCAGATTGGAACAGTGGAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000341983.4 | 3UTR | CCCACCACCAUCUCAGGAAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1462573 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl BaL |
Location of target site | ENST00000341983.4 | 3UTR | CCCACCACCAUCUCAGGAAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000341983.4 | 3UTR | CCUCUGCCGCCCACCACCAUCUCAGGAAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
94 hsa-miR-4708-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT095681 | RBM27 | RNA binding motif protein 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT104033 | USP42 | ubiquitin specific peptidase 42 | ![]() |
![]() |
2 | 6 | ||||||
MIRT114773 | CMPK1 | cytidine/uridine monophosphate kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT246923 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT392569 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443949 | LRIT3 | leucine rich repeat, Ig-like and transmembrane domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446695 | PAPPA | pappalysin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447383 | VOPP1 | vesicular, overexpressed in cancer, prosurvival protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449321 | FAM120AOS | family with sequence similarity 120A opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT449717 | C1orf61 | chromosome 1 open reading frame 61 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449738 | TAB2 | TGF-beta activated kinase 1/MAP3K7 binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450531 | PGLS | 6-phosphogluconolactonase | ![]() |
![]() |
2 | 2 | ||||||
MIRT455650 | YARS | tyrosyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT458036 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463468 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT466677 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | ![]() |
![]() |
2 | 4 | ||||||
MIRT467789 | SLC2A14 | solute carrier family 2 member 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468167 | SGPL1 | sphingosine-1-phosphate lyase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468652 | SECISBP2L | SECIS binding protein 2 like | ![]() |
![]() |
2 | 6 | ||||||
MIRT469380 | RER1 | retention in endoplasmic reticulum sorting receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470346 | PPP2R5E | protein phosphatase 2 regulatory subunit B'epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT472418 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474612 | KLF3 | Kruppel like factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478703 | CSRNP2 | cysteine and serine rich nuclear protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481008 | BBC3 | BCL2 binding component 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483098 | TFPI | tissue factor pathway inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT485113 | SHISA6 | shisa family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497533 | ZNF607 | zinc finger protein 607 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500644 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 6 | ||||||
MIRT500890 | STRN | striatin | ![]() |
![]() |
2 | 4 | ||||||
MIRT501900 | MED13 | mediator complex subunit 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506646 | MAPK1 | mitogen-activated protein kinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512675 | ENO4 | enolase family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516977 | OR7D2 | olfactory receptor family 7 subfamily D member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528754 | RPS27 | ribosomal protein S27 | ![]() |
![]() |
2 | 6 | ||||||
MIRT539670 | ZBTB44 | zinc finger and BTB domain containing 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544129 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546382 | STOX2 | storkhead box 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT562143 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568713 | TMEM30B | transmembrane protein 30B | ![]() |
![]() |
2 | 2 | ||||||
MIRT571029 | CENPP | centromere protein P | ![]() |
![]() |
2 | 2 | ||||||
MIRT572781 | ZNF277 | zinc finger protein 277 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573162 | SLC30A9 | solute carrier family 30 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609126 | NUDT3 | nudix hydrolase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609284 | OAS3 | 2'-5'-oligoadenylate synthetase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613430 | GALNT6 | polypeptide N-acetylgalactosaminyltransferase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613770 | TTC38 | tetratricopeptide repeat domain 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616645 | LRAT | lecithin retinol acyltransferase | ![]() |
![]() |
2 | 4 | ||||||
MIRT630892 | SLC25A33 | solute carrier family 25 member 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636526 | FAXC | failed axon connections homolog | ![]() |
![]() |
2 | 4 | ||||||
MIRT641394 | NUBPL | nucleotide binding protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT641412 | SCN2B | sodium voltage-gated channel beta subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642528 | CERS4 | ceramide synthase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643186 | HYPK | huntingtin interacting protein K | ![]() |
![]() |
2 | 2 | ||||||
MIRT647800 | FRMD8 | FERM domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652150 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652602 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT661606 | C2orf15 | chromosome 2 open reading frame 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666339 | SKAP2 | src kinase associated phosphoprotein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670414 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671122 | ZNF573 | zinc finger protein 573 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671155 | ANKRD9 | ankyrin repeat domain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671338 | FAM71F2 | family with sequence similarity 71 member F2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671869 | ZNF429 | zinc finger protein 429 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671974 | IKZF3 | IKAROS family zinc finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672064 | KIAA0930 | KIAA0930 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672654 | SLC25A16 | solute carrier family 25 member 16 | ![]() |
![]() |
2 | 4 | ||||||
MIRT672673 | GTF2H5 | general transcription factor IIH subunit 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672771 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672929 | LRRC2 | leucine rich repeat containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673159 | C1orf50 | chromosome 1 open reading frame 50 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673272 | RUNDC1 | RUN domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673332 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673351 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673667 | ZNF440 | zinc finger protein 440 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673904 | DCTN6 | dynactin subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674096 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674401 | MYCBP | MYC binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT674525 | PRR23A | proline rich 23A | ![]() |
![]() |
2 | 2 | ||||||
MIRT674793 | NPR1 | natriuretic peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674833 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675066 | FGD6 | FYVE, RhoGEF and PH domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675080 | CCR6 | C-C motif chemokine receptor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675126 | FSD2 | fibronectin type III and SPRY domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679401 | IL10RB | interleukin 10 receptor subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT689229 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694008 | PPIL4 | peptidylprolyl isomerase like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699671 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706213 | ACOT9 | acyl-CoA thioesterase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706548 | GJD2 | gap junction protein delta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707418 | RRP7A | ribosomal RNA processing 7 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT710648 | GLUL | glutamate-ammonia ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT719393 | NPCA1 | Nasopharyngeal carcinoma 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720166 | PNPO | pyridoxamine 5'-phosphate oxidase | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|