miRTarBase - #MIRT481303


—
pre-miRNA Information
pre-miRNA hsa-mir-4301   
Genomic Coordinates chr11: 113450023 - 113450088
Description Homo sapiens miR-4301 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4301
Sequence 11| UCCCACUACUUCACUUGUGA |30
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs184176277 2 dbSNP
rs1191324913 13 dbSNP
rs1369198005 15 dbSNP
rs1036973189 16 dbSNP
rs944900541 18 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATP5G3   
Synonyms P3
Description ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9)
Transcript NM_001190329   
Other Transcripts NM_001002258 , NM_001689   
Expression
Putative miRNA Targets on ATP5G3
3'UTR of ATP5G3
(miRNA target sites are highlighted)		 
>ATP5G3|NM_001190329|3'UTR
   1 TCATTTCTATCCCTAAATAAGTTAAGAGCATGCTTGCAGTAGTTGGAAACTTAGCTACTGAAATAATAGCTACTTTGCAT
  81 TAAGTGCTTACTCTGTGTCTTGCATTATATTTAAAGGGCTTTGTATGCATTATCTCACTTAATTCTCATAACACCATTTG
 161 GGGTGTTATGAGAATAACATCTATGAAGGACTAGAGACACAGAGGCCACATTACTTGCCCAGGTCATAGCTAGTAAATGT
 241 CAGAAAATGAATTTTAACTAAGTCTGACTTCAGAGTCTGCATTCCTAATTGTTAAGCTATTTTGGGAATAAAATTATTAG
 321 AGCACATTCCTTAAAAGGATCAATTTATTTTATTTAAGACCTAAACTGTCAGATCTTAAAAGGTATAGATCATATTTTCA
 401 GATGGATAAGAATGTCAGAACCCATCAAAATGAATGAAAACTAACCATTTATATTGACAGACAGCTCCCTACCTTTACAC
 481 CATATTATCAGGATTGAAGGAGAATAGTGTAAGAGAGATCTAGGCAAATACTCTTCCAGCAGACTTTTCAGTTTACAAAA
 561 ATCCCCACACTAGTAATCTGATTCTTTAACATTTACCAAACATGTTGAAATTAATATTTCAAAGTAACAGTCATATGTGG
 641 TCTCTTTTAGAAACCCTTCGCTGAAGCAGCAGCTGTTCTCATATGCTATCCTGGGATTTGCCTTGTCTGAAGCTATGGGT
 721 CTCTTTTGTTTGATGGTTGCTTTCTTGATTTTGTTTGCCATGTAACAAATTACTGCTTGACATGTTGGCATTCATATTAA
 801 TTACGGATGTAATTCTGTGTATCTTACTGTGACTCCGAAAACTGTAGTATTGGTGTCATGGGAATGTACGTTATTTCCAA
 881 AGTCATTTCATTAAAGATGAAAACTTTAATTTCTTCTGTGATTTGTACTTACACTAAGTTTAGATTATCACAAAGAAGAA
 961 CGTGCATTCAGGCAGATGCTGTCCCATTCAGAGGAAGCTACAGCAGTTGCTCCACTGATGAAAAATATTCCAATGTAATT
1041 TTTATGGGAATTCTTTTATATAGTGTTCTGCATATTGTAATTCATAGGGCTTTTGTTTATTCATATAAAGGATAAATATT
1121 TGGGTGTTTTGAGCTTCTATAAAATATGATTAATTAAAGGTAGTTAATACTCAAGATGGTCTTGAGTTTTTAAGGTCTAA
1201 CATCAGTTAGAATACTTCAAATCAGAATCACCTTCCAAGACTGACTTGACAGGTGGTTCTAAAAATAAATCACGTCAGCT
1281 TTTTAGGAAATGAAGCCTTAAGCTAGGGGGTAATGTGACTTTTGTTTTTCAGTAAGTCTCACATTAAGCAATTGTGTGCC
1361 TCTAATGAATCTTCCATGTCTTTTCAGAACAGGCTCAGTCCAACTAGCAGCTAGTTTCTTACTTGAACAAGACTATTAAA
1441 AACCAAATATCAAAAAACTGAATTGGCTAGATTTTTACAGCCAAAAATTGCTGTAAGGCAGTGTGTATCACTGTTGCTAA
1521 CATGTTTATAGTGGGAGTCTTGGGGATGATAGCTGGTTCAACAGTATTTTGCTGCTAATACTTTATGTTGCTTCTTGGTC
1601 AAACTTTTCCCATTCAAAGGAAGAAGATGGTGCTACTATAGACAGTTTTTCCCCTAGCAAATATATTGTACCATAATATC
1681 TATCATCCAAGTTTCAGGGTTTTTTGAAAGTTGATAATTAGGAAAGTGACATTTTACTTTTCTTAGTGCCCTTTGCCTGT
1761 TTGATTTCCATTGAGAAAGAGCAGTCACCAAAGTTCCTCAAGTGTCGGAAGACCACCTCCATCAGAATCAGTGCTTGTTT
1841 AAAAAATAAAAATCCCTAGGTTCCAGACCTACTGAATTGGACTCTTTGGACATGAGACTCAGCAATCTACATCTTTAAAA
1921 AGGCTTCCCAGGTGGTTTTTGTGCATACTGTTTGAGAGTCACTAAGTTATATATATATCCTACCTTCTGTAAAGTGAAAT
2001 GAGGCCCCAAAAAGCTAAAGAGGTAGAGCTGCTACCTCGTTTTTAGTTGATTCATCATCTAGTCTATATCACCCAAAAGA
2081 ATTGGAAATAGGTATTCAAACAAAAACCTGTATACAAGTATTCATAGAAGCACTACTTACAATAGCCGAAAGGTAGAAAC
2161 AACCAAATGTCTATCAGCTGATGAATGGATAAGTAAAATACATCCATATAATGGAATATTCAGCCATGAAAAGGAATGAG
2241 GCACTGATACATAATGAATAGATGTGAGTGAACCCTAAGAAAGCATGCTAAGTGGAAGAAGCCAGCCACATGATTCCATT
2321 TATATGAAATATCCAAAATAGGCAAATCCACGGTGACAAAGCCAATTAGTAGTTATCAGGAACTAGGGAGGGGGTGAAAA
2401 GGGAGTGACTGCGTAATGCGTATGGGGATTCCTTTTAGGATGATGAAAATTGGATGAATTACAGCTGGTCTGATGGTAGT
2481 GGGTTATCAGAACTTATTAACATTAGTGTCATTAAAGTTGGTATATAGCCCCTCACTGCTAAATCTGGCTCAAAAATTAA
2561 AAGATTATTAAAATTTGATGAATTAGTGGTGATGGTTGCACAACATTGTAAATATAATAAATGTCACTGAATTGTACACT
2641 TTAAGGTGGTTAAAATGGCAAATTTTACATGTCTTACTGAAACTACTATTTAATACAAAGTACATAGTATAAAATTTTAA
2721 AAGTGATAGGAAAATGCTTAGATTAATATTCACCTATTCCAAGTATATTTTAAATAAAAACAGTCTTGGTAAAGAAAAAA
2801 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agUGUUCACUUCAUCACCCu 5'
            ||| ||  | ||||||| 
Target 5' taACATGTTTA-TAGTGGGa 3'
 1518 - 1536 153.00 -13.20
2 
miRNA  3' aguguucACU-UCAUCACCCu 5'
                 ||| :|||||||| 
Target 5' gctggtcTGATGGTAGTGGGt 3'
 2464 - 2484 153.00 -15.30
3 
miRNA  3' aguguucACUUCAUCACCcu 5'
                 |||| ||||||  
Target 5' aatttgaTGAATTAGTGGtg 3'
 2572 - 2591 137.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
976731 654 ClinVar
559376 684 ClinVar
COSN1807631 17 COSMIC
COSN24400575 47 COSMIC
COSN6155311 148 COSMIC
COSN15188540 341 COSMIC
COSN22464639 432 COSMIC
COSN9867096 603 COSMIC
COSM7257000 649 COSMIC
COSM9099069 668 COSMIC
COSM4775480 724 COSMIC
COSM7766220 739 COSMIC
COSN5270158 804 COSMIC
COSN30475230 836 COSMIC
COSN31511521 836 COSMIC
COSN9117402 890 COSMIC
COSN31530005 913 COSMIC
COSN28776638 962 COSMIC
COSN6155310 1107 COSMIC
COSN1807630 1221 COSMIC
COSN20097404 1393 COSMIC
COSN27477780 1393 COSMIC
COSN27385893 1394 COSMIC
COSN20097398 1398 COSMIC
COSN31959800 2082 COSMIC
COSN30295287 2287 COSMIC
COSN28198040 2504 COSMIC
COSN8344659 2535 COSMIC
COSN20097392 2683 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs11545710 7 dbSNP
rs1320884346 10 dbSNP
rs1031065098 12 dbSNP
rs1268342348 13 dbSNP
rs1197356470 15 dbSNP
rs754104094 16 dbSNP
rs1402084450 24 dbSNP
rs767281917 27 dbSNP
rs1204295769 30 dbSNP
rs368778713 33 dbSNP
rs774235101 38 dbSNP
rs1481069767 39 dbSNP
rs1370149557 40 dbSNP
rs112024158 42 dbSNP
rs1345423743 43 dbSNP
rs762468869 46 dbSNP
rs1014580252 49 dbSNP
rs1174570223 57 dbSNP
rs1356551610 63 dbSNP
rs936204348 66 dbSNP
rs924871978 72 dbSNP
rs1302631707 78 dbSNP
rs535801164 84 dbSNP
rs1346023302 91 dbSNP
rs1406720919 93 dbSNP
rs571895706 94 dbSNP
rs894432078 95 dbSNP
rs1215006630 99 dbSNP
rs1158828802 111 dbSNP
rs188186657 118 dbSNP
rs567032861 122 dbSNP
rs374434508 128 dbSNP
rs977594277 131 dbSNP
rs1471832063 136 dbSNP
rs930278281 140 dbSNP
rs1249122240 142 dbSNP
rs754809816 156 dbSNP
rs268223 163 dbSNP
rs1036046437 169 dbSNP
rs766609331 170 dbSNP
rs763044680 179 dbSNP
rs1016855517 183 dbSNP
rs1187482607 187 dbSNP
rs1207416017 189 dbSNP
rs1423007483 189 dbSNP
rs984097042 191 dbSNP
rs143234192 200 dbSNP
rs1026671597 212 dbSNP
rs868560431 215 dbSNP
rs1296254658 221 dbSNP
rs1268730227 222 dbSNP
rs527929781 223 dbSNP
rs901710317 231 dbSNP
rs1326877041 235 dbSNP
rs1271750604 237 dbSNP
rs1315099287 239 dbSNP
rs1018695834 240 dbSNP
rs1396897189 264 dbSNP
rs1378725028 279 dbSNP
rs987689673 285 dbSNP
rs1315362345 302 dbSNP
rs1360966210 316 dbSNP
rs1213893690 319 dbSNP
rs1282696036 327 dbSNP
rs115076542 330 dbSNP
rs1433008681 341 dbSNP
rs1216901282 343 dbSNP
rs1244216200 346 dbSNP
rs1443219992 347 dbSNP
rs1183192434 357 dbSNP
rs1386158196 370 dbSNP
rs1446460958 375 dbSNP
rs1389966606 386 dbSNP
rs184571077 400 dbSNP
rs1401242810 401 dbSNP
rs61204490 428 dbSNP
rs999880859 429 dbSNP
rs533225387 431 dbSNP
rs958003686 433 dbSNP
rs1336961882 442 dbSNP
rs1420542698 446 dbSNP
rs1031033993 448 dbSNP
rs903417847 452 dbSNP
rs1278474862 459 dbSNP
rs1350525379 465 dbSNP
rs1000006288 471 dbSNP
rs1287002363 478 dbSNP
rs970872735 482 dbSNP
rs80046353 491 dbSNP
rs1243908249 499 dbSNP
rs1179694785 505 dbSNP
rs1014050530 509 dbSNP
rs950242414 512 dbSNP
rs1470578887 516 dbSNP
rs112403457 523 dbSNP
rs1055896799 525 dbSNP
rs1469043996 541 dbSNP
rs1337150751 542 dbSNP
rs1407788246 543 dbSNP
rs937397375 546 dbSNP
rs1389341566 558 dbSNP
rs573097656 563 dbSNP
rs561077001 576 dbSNP
rs1208093217 578 dbSNP
rs111351205 583 dbSNP
rs575168732 589 dbSNP
rs112693157 590 dbSNP
rs940426045 596 dbSNP
rs556971642 597 dbSNP
rs769389090 602 dbSNP
rs772583219 604 dbSNP
rs1367889493 607 dbSNP
rs769413346 608 dbSNP
rs750331218 610 dbSNP
rs919175870 614 dbSNP
rs139853278 622 dbSNP
rs776445504 628 dbSNP
rs1469286640 629 dbSNP
rs769099665 630 dbSNP
rs372858991 633 dbSNP
rs1434932866 635 dbSNP
rs577775985 636 dbSNP
rs1184089841 642 dbSNP
rs1007412561 644 dbSNP
rs758815637 646 dbSNP
rs989715676 649 dbSNP
rs368481568 651 dbSNP
rs1431125989 652 dbSNP
rs778823062 653 dbSNP
rs757411192 654 dbSNP
rs1199660343 655 dbSNP
rs1323463815 656 dbSNP
rs953085299 657 dbSNP
rs754014046 659 dbSNP
rs777341021 660 dbSNP
rs1312301235 669 dbSNP
rs1396784411 681 dbSNP
rs8106 684 dbSNP
rs534857186 690 dbSNP
rs1300782242 691 dbSNP
rs1204950100 705 dbSNP
rs1375063191 711 dbSNP
rs1331795591 713 dbSNP
rs1244408492 714 dbSNP
rs1358193626 715 dbSNP
rs1297659376 720 dbSNP
rs1451570782 721 dbSNP
rs1403846754 725 dbSNP
rs1338580288 726 dbSNP
rs1466461225 728 dbSNP
rs766254921 729 dbSNP
rs146174090 732 dbSNP
rs1324348155 733 dbSNP
rs1062642 741 dbSNP
rs764602797 742 dbSNP
rs761438467 745 dbSNP
rs776355506 750 dbSNP
rs777867642 768 dbSNP
rs756169521 769 dbSNP
rs761145834 773 dbSNP
rs768433692 774 dbSNP
rs1062643 777 dbSNP
rs1062644 781 dbSNP
rs371891238 782 dbSNP
rs772522917 793 dbSNP
rs746341847 794 dbSNP
rs779501762 796 dbSNP
rs1062645 797 dbSNP
rs146499950 804 dbSNP
rs200123454 805 dbSNP
rs1490220591 810 dbSNP
rs748839232 819 dbSNP
rs1200020514 825 dbSNP
rs1062646 826 dbSNP
rs1269405203 827 dbSNP
rs958507662 836 dbSNP
rs1210175692 837 dbSNP
rs1034168986 839 dbSNP
rs1062647 840 dbSNP
rs537727494 843 dbSNP
rs1161336664 846 dbSNP
rs1263878932 846 dbSNP
rs532045372 847 dbSNP
rs1393528807 848 dbSNP
rs1062648 850 dbSNP
rs1380816592 852 dbSNP
rs765004350 852 dbSNP
rs193202175 854 dbSNP
rs1062649 862 dbSNP
rs899121394 869 dbSNP
rs1226292303 870 dbSNP
rs1015000033 875 dbSNP
rs1358813357 877 dbSNP
rs532165725 879 dbSNP
rs1062650 880 dbSNP
rs890123484 882 dbSNP
rs1302623408 887 dbSNP
rs1262143242 896 dbSNP
rs189393963 904 dbSNP
rs931745403 908 dbSNP
rs1053993765 914 dbSNP
rs1366005147 923 dbSNP
rs1164935139 932 dbSNP
rs528317882 932 dbSNP
rs1431183391 933 dbSNP
rs1370660635 943 dbSNP
rs1452285275 944 dbSNP
rs1288844125 946 dbSNP
rs370822498 958 dbSNP
rs1437806334 961 dbSNP
rs77008436 961 dbSNP
rs2288960 962 dbSNP
rs563286372 973 dbSNP
rs1199551112 980 dbSNP
rs1238205491 981 dbSNP
rs1432370062 986 dbSNP
rs929992695 997 dbSNP
rs918545565 1004 dbSNP
rs1184081407 1017 dbSNP
rs1483471457 1024 dbSNP
rs544978451 1026 dbSNP
rs184216619 1030 dbSNP
rs917930465 1035 dbSNP
rs911830841 1049 dbSNP
rs990900853 1052 dbSNP
rs959477568 1053 dbSNP
rs1364937288 1063 dbSNP
rs1034137576 1085 dbSNP
rs985943314 1090 dbSNP
rs1174765810 1094 dbSNP
rs1405561965 1109 dbSNP
rs1453629056 1110 dbSNP
rs1304852935 1112 dbSNP
rs953223121 1119 dbSNP
rs1371274662 1121 dbSNP
rs1390954566 1123 dbSNP
rs1307555136 1132 dbSNP
rs1331145677 1137 dbSNP
rs1221417744 1139 dbSNP
rs73039758 1140 dbSNP
rs1324059940 1148 dbSNP
rs1211757981 1154 dbSNP
rs1347281115 1160 dbSNP
rs1480019072 1163 dbSNP
rs1000313646 1170 dbSNP
rs963184304 1171 dbSNP
rs1233244929 1174 dbSNP
rs1014807218 1182 dbSNP
rs1005218962 1201 dbSNP
rs34269513 1202 dbSNP
rs890111689 1202 dbSNP
rs1178488210 1203 dbSNP
rs574185797 1208 dbSNP
rs1020341358 1218 dbSNP
rs1013939297 1231 dbSNP
rs1290538189 1236 dbSNP
rs1461484314 1238 dbSNP
rs555900989 1253 dbSNP
rs1410856761 1255 dbSNP
rs896036128 1261 dbSNP
rs1352208906 1273 dbSNP
rs1403006475 1274 dbSNP
rs1282609697 1275 dbSNP
rs995919999 1288 dbSNP
rs537360056 1303 dbSNP
rs1034590631 1305 dbSNP
rs367769912 1306 dbSNP
rs1001649088 1307 dbSNP
rs900294814 1318 dbSNP
rs888652020 1322 dbSNP
rs1276127765 1324 dbSNP
rs1489660376 1335 dbSNP
rs1053536337 1338 dbSNP
rs1048548476 1342 dbSNP
rs1307071101 1343 dbSNP
rs1478526122 1349 dbSNP
rs1193288346 1356 dbSNP
rs1389148890 1358 dbSNP
rs936789703 1362 dbSNP
rs201731200 1393 dbSNP
rs200593405 1394 dbSNP
rs57022618 1397 dbSNP
rs765925401 1397 dbSNP
rs201725055 1399 dbSNP
rs200805026 1400 dbSNP
rs74363296 1401 dbSNP
rs138006867 1402 dbSNP
rs58350508 1402 dbSNP
rs71405956 1402 dbSNP
rs751115247 1402 dbSNP
rs1465421012 1403 dbSNP
rs569976256 1414 dbSNP
rs1161043593 1422 dbSNP
rs1041421460 1425 dbSNP
rs938094132 1438 dbSNP
rs944076657 1443 dbSNP
rs919970342 1450 dbSNP
rs1180367641 1456 dbSNP
rs557734932 1463 dbSNP
rs1361073307 1464 dbSNP
rs539497755 1467 dbSNP
rs1214763761 1469 dbSNP
rs974134970 1477 dbSNP
rs1444197703 1487 dbSNP
rs565729588 1489 dbSNP
rs986081087 1492 dbSNP
rs1291601913 1500 dbSNP
rs907717406 1500 dbSNP
rs1373996258 1507 dbSNP
rs931887844 1518 dbSNP
rs925741589 1520 dbSNP
rs1240701673 1521 dbSNP
rs1170794270 1529 dbSNP
rs1485771001 1537 dbSNP
rs983376533 1540 dbSNP
rs1442800096 1542 dbSNP
rs978630396 1547 dbSNP
rs1229364935 1553 dbSNP
rs186887925 1555 dbSNP
rs1020053831 1556 dbSNP
rs1029997109 1564 dbSNP
rs182384661 1572 dbSNP
rs1341893815 1574 dbSNP
rs1334175886 1575 dbSNP
rs959730923 1584 dbSNP
rs1034560896 1585 dbSNP
rs1380125645 1594 dbSNP
rs567368388 1598 dbSNP
rs1244544859 1604 dbSNP
rs1315161891 1609 dbSNP
rs549125130 1615 dbSNP
rs1403764006 1622 dbSNP
rs193064990 1623 dbSNP
rs771737602 1625 dbSNP
rs1230500482 1634 dbSNP
rs1282854035 1636 dbSNP
rs1316687255 1637 dbSNP
rs189212387 1639 dbSNP
rs1209766152 1642 dbSNP
rs1250064611 1645 dbSNP
rs1460176702 1646 dbSNP
rs1322511653 1650 dbSNP
rs888707716 1651 dbSNP
rs1027541239 1652 dbSNP
rs1238094643 1656 dbSNP
rs1473854890 1658 dbSNP
rs1156728868 1672 dbSNP
rs1407178859 1673 dbSNP
rs545317291 1680 dbSNP
rs994367084 1682 dbSNP
rs376680344 1685 dbSNP
rs1457562800 1687 dbSNP
rs1000635497 1688 dbSNP
rs1411047463 1690 dbSNP
rs1156599313 1695 dbSNP
rs1403378620 1698 dbSNP
rs1473865458 1699 dbSNP
rs1337031847 1706 dbSNP
rs1341741691 1707 dbSNP
rs79186086 1710 dbSNP
rs1041164426 1714 dbSNP
rs944030144 1719 dbSNP
rs889831720 1736 dbSNP
rs1229352682 1742 dbSNP
rs1440812732 1746 dbSNP
rs1042978948 1759 dbSNP
rs1203266105 1764 dbSNP
rs1279675256 1770 dbSNP
rs1444144429 1775 dbSNP
rs1049765141 1777 dbSNP
rs1179752935 1778 dbSNP
rs1232189357 1779 dbSNP
rs564103733 1780 dbSNP
rs1209963037 1794 dbSNP
rs931856688 1796 dbSNP
rs183413738 1806 dbSNP
rs1469164274 1807 dbSNP
rs978983320 1811 dbSNP
rs1172790406 1812 dbSNP
rs1403927548 1814 dbSNP
rs268222 1818 dbSNP
rs1327641411 1820 dbSNP
rs1055305930 1821 dbSNP
rs1410953406 1823 dbSNP
rs1290821244 1827 dbSNP
rs564939857 1828 dbSNP
rs937978112 1832 dbSNP
rs912962807 1858 dbSNP
rs1223293498 1863 dbSNP
rs992629595 1865 dbSNP
rs919937753 1881 dbSNP
rs573647375 1887 dbSNP
rs555692544 1892 dbSNP
rs779644368 1894 dbSNP
rs1483444221 1913 dbSNP
rs940131820 1924 dbSNP
rs907695628 1930 dbSNP
rs1266760184 1942 dbSNP
rs1479957116 1947 dbSNP
rs1199312746 1948 dbSNP
rs1378965536 1950 dbSNP
rs1474235913 1951 dbSNP
rs1380001712 1954 dbSNP
rs979753161 1973 dbSNP
rs1310326472 1976 dbSNP
rs1364255443 1977 dbSNP
rs1299729321 1979 dbSNP
rs1302435564 1979 dbSNP
rs1386520555 1979 dbSNP
rs983730802 1980 dbSNP
rs1269902097 1982 dbSNP
rs954573532 1984 dbSNP
rs923148508 1991 dbSNP
rs952943907 1995 dbSNP
rs115728447 1996 dbSNP
rs994730735 2000 dbSNP
rs1315903685 2004 dbSNP
rs961601772 2006 dbSNP
rs1020115168 2011 dbSNP
rs1445108547 2017 dbSNP
rs1192008091 2018 dbSNP
rs1390417185 2020 dbSNP
rs1008280837 2023 dbSNP
rs1406912366 2036 dbSNP
rs1450718691 2037 dbSNP
rs1161164999 2038 dbSNP
rs1391688835 2039 dbSNP
rs80154192 2044 dbSNP
rs1393318449 2053 dbSNP
rs139204706 2066 dbSNP
rs1320079120 2072 dbSNP
rs191880881 2082 dbSNP
rs1437319925 2086 dbSNP
rs572138554 2088 dbSNP
rs966896106 2089 dbSNP
rs750668746 2091 dbSNP
rs765492120 2102 dbSNP
rs1449327485 2107 dbSNP
rs1014131079 2109 dbSNP
rs896658799 2113 dbSNP
rs1204334656 2115 dbSNP
rs1055273357 2116 dbSNP
rs1452588299 2118 dbSNP
rs1290117001 2124 dbSNP
rs150784838 2125 dbSNP
rs913023553 2140 dbSNP
rs72929310 2147 dbSNP
rs764730555 2148 dbSNP
rs1370720711 2149 dbSNP
rs1364326079 2173 dbSNP
rs369861964 2174 dbSNP
rs71419425 2175 dbSNP
rs1437522376 2178 dbSNP
rs1335018123 2180 dbSNP
rs1378527491 2191 dbSNP
rs940118120 2192 dbSNP
rs1331529010 2195 dbSNP
rs887153880 2200 dbSNP
rs1227501721 2206 dbSNP
rs1268499852 2220 dbSNP
rs1330995637 2221 dbSNP
rs1201376576 2227 dbSNP
rs142282617 2229 dbSNP
rs1483259523 2236 dbSNP
rs1183105487 2237 dbSNP
rs1258826365 2248 dbSNP
rs185300696 2255 dbSNP
rs1417877813 2256 dbSNP
rs1182155906 2258 dbSNP
rs952410786 2261 dbSNP
rs1459216743 2268 dbSNP
rs920164347 2271 dbSNP
rs374988786 2273 dbSNP
rs1169244479 2290 dbSNP
rs569858236 2302 dbSNP
rs543550219 2310 dbSNP
rs565585513 2312 dbSNP
rs1409100376 2318 dbSNP
rs1478552910 2320 dbSNP
rs1288982048 2334 dbSNP
rs1246423932 2335 dbSNP
rs1008418021 2340 dbSNP
rs1221480853 2341 dbSNP
rs1197733053 2350 dbSNP
rs185584 2351 dbSNP
rs1249091238 2355 dbSNP
rs1028439308 2365 dbSNP
rs1482465898 2372 dbSNP
rs1000857866 2377 dbSNP
rs903890464 2384 dbSNP
rs1253242431 2388 dbSNP
rs1473737676 2389 dbSNP
rs979545389 2390 dbSNP
rs1205219752 2391 dbSNP
rs1433959808 2396 dbSNP
rs767831837 2397 dbSNP
rs1270783830 2400 dbSNP
rs1429251782 2401 dbSNP
rs1308494125 2409 dbSNP
rs372295166 2412 dbSNP
rs11885686 2413 dbSNP
rs1292754592 2418 dbSNP
rs891722099 2419 dbSNP
rs1368104414 2420 dbSNP
rs1220566825 2421 dbSNP
rs182581749 2422 dbSNP
rs1273965426 2426 dbSNP
rs1056871831 2429 dbSNP
rs938544280 2444 dbSNP
rs1275921181 2446 dbSNP
rs1352513558 2448 dbSNP
rs1220067394 2449 dbSNP
rs528981782 2450 dbSNP
rs189602479 2453 dbSNP
rs1388562235 2458 dbSNP
rs1448873879 2462 dbSNP
rs1044159378 2475 dbSNP
rs1391895398 2493 dbSNP
rs930979183 2497 dbSNP
rs1033831639 2500 dbSNP
rs1178861084 2500 dbSNP
rs772783284 2504 dbSNP
rs1286699879 2506 dbSNP
rs972821792 2507 dbSNP
rs1435127358 2516 dbSNP
rs1299150251 2517 dbSNP
rs1017146228 2520 dbSNP
rs1227096482 2521 dbSNP
rs769468386 2523 dbSNP
rs1289858712 2531 dbSNP
rs1322635862 2536 dbSNP
rs1224240167 2537 dbSNP
rs940261293 2539 dbSNP
rs1174679909 2542 dbSNP
rs747677771 2543 dbSNP
rs201877425 2555 dbSNP
rs776076597 2566 dbSNP
rs768582634 2567 dbSNP
rs1162575212 2572 dbSNP
rs543140467 2574 dbSNP
rs780027708 2585 dbSNP
rs758194002 2586 dbSNP
rs1051593257 2588 dbSNP
rs934115606 2589 dbSNP
rs1230605422 2590 dbSNP
rs979470473 2591 dbSNP
rs901665353 2595 dbSNP
rs1442879198 2599 dbSNP
rs968544700 2605 dbSNP
rs576260526 2607 dbSNP
rs1266606578 2615 dbSNP
rs1328957544 2620 dbSNP
rs1209592213 2621 dbSNP
rs1270316347 2621 dbSNP
rs1440717320 2623 dbSNP
rs1186938861 2625 dbSNP
rs943263989 2632 dbSNP
rs185020702 2633 dbSNP
rs1020927379 2637 dbSNP
rs925152234 2639 dbSNP
rs758839776 2643 dbSNP
rs1179975367 2657 dbSNP
rs1410946535 2667 dbSNP
rs375508115 2668 dbSNP
rs1160845561 2671 dbSNP
rs1289202634 2685 dbSNP
rs67632864 2687 dbSNP
rs10701310 2688 dbSNP
rs113992146 2688 dbSNP
rs201179783 2688 dbSNP
rs374553351 2690 dbSNP
rs945006328 2690 dbSNP
rs1371475676 2691 dbSNP
rs369760584 2691 dbSNP
rs1304613172 2693 dbSNP
rs1010003683 2697 dbSNP
rs891695422 2700 dbSNP
rs576255712 2704 dbSNP
rs1035602380 2705 dbSNP
rs1229411332 2714 dbSNP
rs148707747 2717 dbSNP
rs980867900 2719 dbSNP
rs1200140803 2723 dbSNP
rs1279384342 2745 dbSNP
rs1002653812 2750 dbSNP
rs61053606 2759 dbSNP
rs1044212633 2784 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aguguucACU-UCAUCACCCu 5'
                 ||| :|||||||| 
Target 5' gcuggucUGAUGGUAGUGGGu 3'
 		2 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 518.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 518.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 518.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148 PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B PAR-CLIP data was present in SRX1760620. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_A PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_001002258 | 3UTR | GAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903826
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_NS
Location of target site NM_001689 | 3UTR | GAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001689 | 3UTR | CUGCGUAAUGCGUAUGGGGAUUCCUUUUAGGAUGAUGAAAAUUGGAUGAAUUACAGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001689 | 3UTR | GUAUGGGGAUUCCUUUUAGGAUGAUGAAAAUUGGAUGAAUUACAGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001689 | 3UTR | CGUAAUGCGUAUGGGGAUUCCUUUUAGGAUGAUGAAAAUUGGAUGAAUUACAGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001689 | 3UTR | GGGGUGAAAAGGGAGUGACUGCGUAAUGCGUAUGGGGAUUCCUUUUAGGAUGAUGAAAAUUGGAUGAAUUACAGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000284727.4 | 3UTR | GCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAGUUGGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAGUUGGUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 18 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 19 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 20 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000284727.4 | 3UTR | AGCUGGUCUGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
83 hsa-miR-4301 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081134 LDLR low density lipoprotein receptor 2 4
MIRT090911 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT229436 MECP2 methyl-CpG binding protein 2 2 2
MIRT274717 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT350957 BACH1 BTB domain and CNC homolog 1 2 2
MIRT386722 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT446022 PEX3 peroxisomal biogenesis factor 3 2 2
MIRT481303 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 14
MIRT483959 ZNF354B zinc finger protein 354B 2 6
MIRT495667 TUBAL3 tubulin alpha like 3 2 2
MIRT496554 TBX15 T-box 15 2 2
MIRT497702 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 2 2
MIRT498105 RMND5A required for meiotic nuclear division 5 homolog A 2 2
MIRT512535 SEMA4D semaphorin 4D 2 2
MIRT512556 MFN2 mitofusin 2 2 6
MIRT521465 RABGAP1 RAB GTPase activating protein 1 2 6
MIRT526236 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT526743 HLA-DOB major histocompatibility complex, class II, DO beta 2 2
MIRT527578 BRD7 bromodomain containing 7 2 4
MIRT528038 WT1 Wilms tumor 1 2 2
MIRT528267 GPRIN2 G protein regulated inducer of neurite outgrowth 2 2 2
MIRT528505 HTR7 5-hydroxytryptamine receptor 7 2 4
MIRT528758 RPS27 ribosomal protein S27 2 6
MIRT528999 IPO9 importin 9 2 2
MIRT529701 MRPL30 mitochondrial ribosomal protein L30 2 2
MIRT529781 C17orf82 chromosome 17 open reading frame 82 2 2
MIRT533797 TMEM119 transmembrane protein 119 2 6
MIRT535308 PHF12 PHD finger protein 12 2 2
MIRT535917 MKL2 MKL1/myocardin like 2 2 2
MIRT544892 OSBPL1A oxysterol binding protein like 1A 2 2
MIRT555423 PPIC peptidylprolyl isomerase C 2 2
MIRT562068 KLHL15 kelch like family member 15 2 2
MIRT565623 SLC31A1 solute carrier family 31 member 1 2 2
MIRT565661 SIX1 SIX homeobox 1 2 2
MIRT570138 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT571045 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT621232 LMAN1 lectin, mannose binding 1 2 2
MIRT622272 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623844 GAN gigaxonin 2 2
MIRT626158 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT626464 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT632087 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT637243 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT642710 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT643611 KANSL3 KAT8 regulatory NSL complex subunit 3 2 2
MIRT644270 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT645470 SPIN3 spindlin family member 3 2 2
MIRT649193 DNPEP aspartyl aminopeptidase 2 2
MIRT650776 POP4 POP4 homolog, ribonuclease P/MRP subunit 2 2
MIRT651345 ZC2HC1C zinc finger C2HC-type containing 1C 2 2
MIRT652237 TRAPPC3L trafficking protein particle complex 3 like 2 2
MIRT652587 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654591 PURA purine rich element binding protein A 2 2
MIRT654649 PTAFR platelet activating factor receptor 2 2
MIRT656842 KLF7 Kruppel like factor 7 2 2
MIRT657209 IKZF2 IKAROS family zinc finger 2 2 2
MIRT658513 ETV3 ETS variant 3 2 2
MIRT659448 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT668816 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT669067 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT677711 ELOF1 elongation factor 1 homolog 2 4
MIRT687146 PTPN12 protein tyrosine phosphatase, non-receptor type 12 2 2
MIRT698498 THOC2 THO complex 2 2 2
MIRT707930 PPP1R3D protein phosphatase 1 regulatory subunit 3D 4 2
MIRT708737 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710031 POLL DNA polymerase lambda 2 2
MIRT712175 STK4 serine/threonine kinase 4 2 2
MIRT715297 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT716892 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT717378 RBM41 RNA binding motif protein 41 2 2
MIRT718082 CLIC5 chloride intracellular channel 5 2 2
MIRT718721 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT719152 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719224 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT719528 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT719861 KLF2 Kruppel like factor 2 2 2
MIRT720326 CAMK2G calcium/calmodulin dependent protein kinase II gamma 2 2
MIRT721596 SREBF1 sterol regulatory element binding transcription factor 1 2 2
MIRT722020 NEBL nebulette 2 2
MIRT722484 QSOX1 quiescin sulfhydryl oxidase 1 2 2
MIRT722614 TEAD1 TEA domain transcription factor 1 2 2
MIRT723664 RPTN repetin 2 2
MIRT723939 SVOP SV2 related protein 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4301 Cisplatin 5460033 NSC119875 approved sensitive High Hepatocellular Carcinoma cell line (Hep3B, 97L)
hsa-miR-4301 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-mir-4301 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-mir-4301 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-4301 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-4301 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-4301 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-miR-4301 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4301 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission