>ARL6IP1|NM_015161|3'UTR
   1 TTCATCTGCTTTAATCAGTGTGATTAATGCAGCACCCATTGCCCCGGGAACCGTTTCTGCTGTACTATCTGGATACTAAA
  81 ATGTTACGGAAGTAGCTCTTTGTTCTCCCTCACTCTGCCCTTAGTTAATAGAAATTCAGACTCGCCAAGTAAGGCTTCGT
 161 GCATAGTGTCTTCATGTCGCGTATAGTTGAGCGCGTTCTTAGCAGTTGGCTTCATGGACAACTCATTAGTGTTTTGACTT
 241 TTCTTACCCAGCGTTAATTGAATTCTTGCTTTTAGACAACTTCCTTTTTGTAGTGGTGAACCTTGCCCTTTAGTACAGTT
 321 CAAGTGAATCTGGATAATTGTTCATCTTTGCTTTAGCTTAGATACCATGTAGTGGTCTGTGGCTACAGGAAGCTGGTTCT
 401 GTCTGCTTCCACAGTCTGCTTAAAAAACTGTCTGACTTCGTGAATATAGAGACCAAGTTTACCACTTCTGATGAAGAGAC
 481 CAATTAAGATTCATTCCTCATTCTGTTTCTTTCCAGTGGGAGAAGAGTCCCCATGAAATAAGATGAAACTGATTCCATGC
 561 ACTAGTACATGTAGGCTTCTCCCTTGTGCAAAGCTTAGCAATTTGTAGGAAACTTTGATCTTTTTGTCCAAGAAAAGGAA
 641 TGTCTGACAGGCTTAAGCTTTCGTCCCCTTGCACTTAGACTCGAAGTTAGTAAATCCTTAAAGGCTTTTTAATAGCAGAC
 721 TTCCAAAAGATTGCATTTAGGATTTCTAGCATGCTTTTAATTTCAGATTTTCAGCTGACATTAGCTATAGTATACAGTAG
 801 GTTAAGACTCATGTCTATGACTTTCACTCTAAGACTGGCAAAAGGACAGCAGTCTTCTATGTTTAGTCAATATTCATTTC
 881 AGTAGAAGATAATCTTATCTAATTTTTGAGACCAGAATAAGCCTTTTAAGGTAAACCTCAAAATTATCATTTTATGGTAA
 961 TACTGACCATTTTAGTCCCCTAGGTTTGACATGGGAGATAGTGACTACACTGGTGTCTGACTTTTTTCCTAGAGATTTCT
1041 CCCTGAAAAATACAAGGGCTGTTGGTGAGAGCAGACTTGAGGTGATGATAGTTGGCCTCTGGTCTACAAAGATTTCATAA
1121 CTCCTTGGAAAGCTTCTTATAATCATTCTTAACTTCTTGGTAGCTAGAAATTTAGAGTAGTTGAAATCTTTAGGAATGAA
1201 CTTCTGAGGGCCAAAAAATGTGACTGACGGGAACAATTCTTAAACTGATTAACTAGCTGTAATATAGTTTTGTGAATTTA
1281 TTGCACTGATGTTGTACCTTGTGGTATATCTGTCCCTATTAAATAAGTGTTGTTTTCTCCTCTTTAATATTGCTGTGAAC
1361 AGTGGTGCCCATTGTAGCATATGTTTGATTTTTTTTTATTATTTCATAAGAAAACTACGTTAATTTTACCTTACTTTCAT
1441 TGTAAATAAGCCTGTCTTCCTATCTGGATTTTTTGTGTGCATACATATTCTACTGATTAACTACTTTTGCAGTTTTAATC
1521 CTGTATTATTTCTTCTACTTTGTTTTGTGTAAAAGGGGAAAAAATAAAAAAAGCTGGAATCTTCAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aggcgGAC-AGACUUGUCACu 5' :|| | ||||||||| Target 5' taataTTGCTGTGAACAGTGg 3'	1345 - 1365	155.00	-16.50
2	miRNA 3' agGCGGAC-AGACUUGUCACu 5' | :||| |:| | ||||| Target 5' ttCATCTGCTTTAATCAGTGt 3'	1 - 21	126.00	-11.90
3	miRNA 3' agGCGGACAGACUUGUCAcu 5' ||| | ||| |:|||| Target 5' agCGCGT-TCTTAGCAGTtg 3'	190 - 208	125.00	-12.40

Mutant ID	Mutant Position	Mutant Source
COSN30500785	43	COSMIC
COSN30177836	47	COSMIC
COSN32049930	82	COSMIC
COSN26966793	87	COSMIC
COSN30532149	87	COSMIC
COSN30103632	155	COSMIC
COSN30497513	180	COSMIC
COSN31507501	192	COSMIC
COSN8230120	211	COSMIC
COSN31523741	251	COSMIC
COSN31518723	285	COSMIC
COSN7300235	659	COSMIC
COSN6545794	683	COSMIC
COSN21266187	829	COSMIC
COSN26715053	1177	COSMIC
COSN22151463	1218	COSMIC
COSN31543522	1229	COSMIC
COSN14821805	1239	COSMIC
COSN31594530	1388	COSMIC
COSN26578795	1398	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs146819027	1	dbSNP
rs763801935	2	dbSNP
rs760427693	4	dbSNP
rs775370872	9	dbSNP
rs1181892998	11	dbSNP
rs375033723	17	dbSNP
rs1413290035	18	dbSNP
rs183897858	19	dbSNP
rs759546317	20	dbSNP
rs1298948925	24	dbSNP
rs1461734758	25	dbSNP
rs774409109	30	dbSNP
rs376630761	35	dbSNP
rs748214929	39	dbSNP
rs776593721	41	dbSNP
rs768805808	42	dbSNP
rs1474089198	43	dbSNP
rs747233970	44	dbSNP
rs571187892	45	dbSNP
rs370377390	46	dbSNP
rs200893931	47	dbSNP
rs1410586488	49	dbSNP
rs758440072	50	dbSNP
rs1334964007	51	dbSNP
rs1333594483	52	dbSNP
rs774280264	53	dbSNP
rs1247654285	54	dbSNP
rs141660729	62	dbSNP
rs920775450	67	dbSNP
rs1285261743	75	dbSNP
rs567375208	79	dbSNP
rs771658610	83	dbSNP
rs1039248899	87	dbSNP
rs942409340	87	dbSNP
rs1343854444	88	dbSNP
rs1195955303	92	dbSNP
rs1254894432	93	dbSNP
rs1486744051	107	dbSNP
rs1255652969	108	dbSNP
rs1199730841	128	dbSNP
rs1243650355	129	dbSNP
rs1480818775	130	dbSNP
rs1166476913	139	dbSNP
rs768437472	143	dbSNP
rs1253056197	144	dbSNP
rs1172163932	156	dbSNP
rs1400198681	159	dbSNP
rs11540998	163	dbSNP
rs1316786358	177	dbSNP
rs527290226	178	dbSNP
rs755826785	179	dbSNP
rs1293290693	181	dbSNP
rs566382602	184	dbSNP
rs1353253765	185	dbSNP
rs1311534160	189	dbSNP
rs780703254	190	dbSNP
rs756731193	192	dbSNP
rs989145021	193	dbSNP
rs957336981	194	dbSNP
rs1397601262	195	dbSNP
rs1198473589	204	dbSNP
rs551351857	205	dbSNP
rs1467700357	206	dbSNP
rs1032786909	214	dbSNP
rs753186014	215	dbSNP
rs1001361241	216	dbSNP
rs1323085793	219	dbSNP
rs1386176927	222	dbSNP
rs970107121	242	dbSNP
rs1300231734	243	dbSNP
rs56284922	249	dbSNP
rs35568693	250	dbSNP
rs1024351097	251	dbSNP
rs1014215880	252	dbSNP
rs886457921	253	dbSNP
rs1327811422	254	dbSNP
rs1206776930	258	dbSNP
rs1269909629	270	dbSNP
rs1486100824	271	dbSNP
rs762608458	285	dbSNP
rs192910252	290	dbSNP
rs995484822	292	dbSNP
rs899440806	302	dbSNP
rs188843925	307	dbSNP
rs183387304	311	dbSNP
rs145797778	313	dbSNP
rs190378018	321	dbSNP
rs1051293495	327	dbSNP
rs1346290322	335	dbSNP
rs1457773984	338	dbSNP
rs1292148857	340	dbSNP
rs933640914	341	dbSNP
rs912875363	346	dbSNP
rs754296049	371	dbSNP
rs1194007221	376	dbSNP
rs1303338856	377	dbSNP
rs568360037	387	dbSNP
rs1226016344	400	dbSNP
rs1273719343	403	dbSNP
rs149832233	411	dbSNP
rs1332010420	422	dbSNP
rs766685540	423	dbSNP
rs1243891831	436	dbSNP
rs1263473321	437	dbSNP
rs139969480	439	dbSNP
rs150703199	440	dbSNP
rs1251326663	443	dbSNP
rs979870601	447	dbSNP
rs1336731497	451	dbSNP
rs1309533596	456	dbSNP
rs1184427959	461	dbSNP
rs1408722585	462	dbSNP
rs1445008888	470	dbSNP
rs143161097	476	dbSNP
rs201113406	483	dbSNP
rs1024320033	485	dbSNP
rs1463123538	486	dbSNP
rs1163883391	494	dbSNP
rs993335423	509	dbSNP
rs1407533891	515	dbSNP
rs139788552	516	dbSNP
rs1325932157	517	dbSNP
rs1373357096	526	dbSNP
rs1026715685	555	dbSNP
rs1162919461	559	dbSNP
rs1310442168	565	dbSNP
rs1361383850	569	dbSNP
rs994889134	569	dbSNP
rs899409695	572	dbSNP
rs537652307	575	dbSNP
rs1233544866	581	dbSNP
rs1482943771	597	dbSNP
rs1258844586	599	dbSNP
rs562941153	604	dbSNP
rs1007695291	629	dbSNP
rs185612741	638	dbSNP
rs1172026437	641	dbSNP
rs1354646980	642	dbSNP
rs890648965	650	dbSNP
rs1301070998	656	dbSNP
rs148111515	662	dbSNP
rs1253602988	663	dbSNP
rs933715423	668	dbSNP
rs1195374361	673	dbSNP
rs767571141	675	dbSNP
rs891580085	677	dbSNP
rs1274187517	678	dbSNP
rs1265977390	681	dbSNP
rs1205370774	682	dbSNP
rs189705410	683	dbSNP
rs935675635	685	dbSNP
rs1265011958	686	dbSNP
rs375397453	686	dbSNP
rs145942409	704	dbSNP
rs1246398096	711	dbSNP
rs1451601734	729	dbSNP
rs1188002369	744	dbSNP
rs1353409230	749	dbSNP
rs980006170	757	dbSNP
rs1173866472	759	dbSNP
rs948528151	772	dbSNP
rs1443700897	789	dbSNP
rs551428769	791	dbSNP
rs1322904683	793	dbSNP
rs1385943315	797	dbSNP
rs1432487898	798	dbSNP
rs761949787	808	dbSNP
rs1382831117	809	dbSNP
rs774261675	821	dbSNP
rs1387497924	825	dbSNP
rs570349781	836	dbSNP
rs532931007	840	dbSNP
rs1324945908	844	dbSNP
rs768625965	848	dbSNP
rs1395416073	853	dbSNP
rs1266346977	857	dbSNP
rs1448903404	864	dbSNP
rs1216783822	870	dbSNP
rs569577182	880	dbSNP
rs1246418588	894	dbSNP
rs1175447901	901	dbSNP
rs1026437091	906	dbSNP
rs55934464	910	dbSNP
rs1197075939	912	dbSNP
rs551257204	934	dbSNP
rs1407347894	936	dbSNP
rs1480741955	942	dbSNP
rs1157711676	947	dbSNP
rs1409147382	950	dbSNP
rs749049314	962	dbSNP
rs775312788	963	dbSNP
rs1318561267	976	dbSNP
rs1349001346	984	dbSNP
rs748881666	992	dbSNP
rs1305379089	1004	dbSNP
rs1017838821	1019	dbSNP
rs769495660	1029	dbSNP
rs777646929	1033	dbSNP
rs745465286	1036	dbSNP
rs780710911	1038	dbSNP
rs1030910729	1048	dbSNP
rs547004305	1051	dbSNP
rs1450129208	1071	dbSNP
rs1219929119	1076	dbSNP
rs1270809639	1085	dbSNP
rs1259291245	1097	dbSNP
rs1490476626	1109	dbSNP
rs1181371360	1113	dbSNP
rs1215377039	1134	dbSNP
rs144758973	1140	dbSNP
rs562191806	1144	dbSNP
rs1470871503	1161	dbSNP
rs1158691951	1165	dbSNP
rs1412579246	1174	dbSNP
rs1049471	1184	dbSNP
rs754332509	1188	dbSNP
rs1165806110	1196	dbSNP
rs1052882290	1198	dbSNP
rs76518069	1199	dbSNP
rs1306709551	1203	dbSNP
rs1338102096	1209	dbSNP
rs1274767154	1211	dbSNP
rs1283708741	1219	dbSNP
rs560768294	1228	dbSNP
rs1328229305	1240	dbSNP
rs1296619627	1247	dbSNP
rs1293588946	1253	dbSNP
rs780970629	1256	dbSNP
rs1359881430	1265	dbSNP
rs1204248544	1271	dbSNP
rs1399564784	1283	dbSNP
rs1375852804	1285	dbSNP
rs1044064462	1297	dbSNP
rs948626059	1298	dbSNP
rs917206720	1323	dbSNP
rs1057362813	1327	dbSNP
rs1385545540	1330	dbSNP
rs1429492510	1339	dbSNP
rs755501780	1339	dbSNP
rs1412541718	1363	dbSNP
rs1424424627	1364	dbSNP
rs1168403657	1366	dbSNP
rs929156388	1368	dbSNP
rs754420543	1372	dbSNP
rs1411038091	1378	dbSNP
rs1333525785	1382	dbSNP
rs1338781351	1383	dbSNP
rs1476121108	1383	dbSNP
rs561836545	1386	dbSNP
rs973495064	1387	dbSNP
rs1364794160	1388	dbSNP
rs1249433937	1391	dbSNP
rs541594785	1397	dbSNP
rs1277208052	1398	dbSNP
rs540565673	1398	dbSNP
rs1459585343	1402	dbSNP
rs986166273	1418	dbSNP
rs1259159398	1419	dbSNP
rs1448535831	1424	dbSNP
rs954941329	1427	dbSNP
rs1375156524	1429	dbSNP
rs780409067	1430	dbSNP
rs1172500336	1431	dbSNP
rs1404611414	1444	dbSNP
rs1470984502	1447	dbSNP
rs1337514532	1453	dbSNP
rs1441014601	1488	dbSNP
rs564570790	1493	dbSNP
rs1278570205	1494	dbSNP
rs1030587136	1495	dbSNP
rs1010116365	1496	dbSNP
rs1227968604	1499	dbSNP
rs1321385437	1504	dbSNP
rs956908355	1512	dbSNP
rs1263248698	1513	dbSNP
rs55939231	1520	dbSNP
rs545813340	1522	dbSNP
rs1263494017	1524	dbSNP
rs1447926907	1535	dbSNP
rs1198657495	1538	dbSNP
rs575193901	1540	dbSNP
rs1341570440	1542	dbSNP
rs1276325410	1545	dbSNP
rs1427776908	1555	dbSNP
rs1031814683	1564	dbSNP
rs904310366	1565	dbSNP
rs999884261	1565	dbSNP
rs1044031192	1568	dbSNP
rs1356417224	1570	dbSNP
rs1290846455	1577	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.