pre-miRNA Information
pre-miRNA hsa-mir-1245a   
Genomic Coordinates chr2: 188978092 - 188978161
Description Homo sapiens miR-1245a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1245a
Sequence 45| AAGUGAUCUAAAGGCCUACAU |65
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31562560 15 COSMIC
COSN26581044 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs906938680 2 dbSNP
rs1159117523 3 dbSNP
rs780486044 6 dbSNP
rs771479866 17 dbSNP
rs1002976932 18 dbSNP
rs1428029219 19 dbSNP
Putative Targets

Gene Information
Gene Symbol APEX1   
Synonyms APE, APE1, APEN, APEX, APX, HAP1, REF1
Description apurinic/apyrimidinic endodeoxyribonuclease 1
Transcript NM_001641   
Other Transcripts NM_080648 , NM_080649   
Expression
Putative miRNA Targets on APEX1
3'UTR of APEX1
(miRNA target sites are highlighted)
>APEX1|NM_001641|3'UTR
   1 CACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTACCATTCCTTCTTTAAACACTCTTCAGAGAAAT
  81 CTGCATTCTATTTCTCATGTATAAAACTAGGAATCCTCCAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTT
 161 TTTATTTGAGGGTTTTTTGTTTTTTAAAAAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCACATGAAA
 241 ATAAAGAGCCATAGTTTCAGCCTTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uacauccGGAAAUCUAGUGAa 5'
                 ||  || |||||| 
Target 5' --caccaCCCCTAAATCACTt 3'
1 - 19 122.00 -8.60
2
miRNA  3' uacauccGGAAAUCUAGUGAa 5'
                 :||||  | |||| 
Target 5' cattcctTCTTT-AAACACTc 3'
50 - 69 89.00 -5.10
3
miRNA  3' uacAUCCGGAAAUCUAGUGAa 5'
             || |||   ||||: :| 
Target 5' tttTAAGCC-CAAGATTTTTt 3'
144 - 163 89.00 -5.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30168709 4 COSMIC
COSN20078120 66 COSMIC
COSN1639515 70 COSMIC
COSN30134914 77 COSMIC
COSN31531919 84 COSMIC
COSN30447950 130 COSMIC
COSN8588396 158 COSMIC
COSN31590643 164 COSMIC
COSN30608908 186 COSMIC
COSN8140352 187 COSMIC
COSN28838135 195 COSMIC
COSN16743853 215 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1301652270 2 dbSNP
rs17112002 3 dbSNP
rs774168347 4 dbSNP
rs1043739629 7 dbSNP
rs1288511432 8 dbSNP
rs12590363 10 dbSNP
rs904741245 14 dbSNP
rs761809761 16 dbSNP
rs942701110 16 dbSNP
rs759225207 19 dbSNP
rs767141318 20 dbSNP
rs1470896360 25 dbSNP
rs752091024 28 dbSNP
rs755638723 33 dbSNP
rs765357238 37 dbSNP
rs1278129567 38 dbSNP
rs764007376 42 dbSNP
rs1485351842 44 dbSNP
rs773464873 47 dbSNP
rs753786698 49 dbSNP
rs193287013 50 dbSNP
rs1282903014 51 dbSNP
rs1211308283 58 dbSNP
rs1436760908 70 dbSNP
rs1179087518 71 dbSNP
rs901275905 83 dbSNP
rs959487488 86 dbSNP
rs1047115775 91 dbSNP
rs1172623581 101 dbSNP
rs1413161887 108 dbSNP
rs1394918746 110 dbSNP
rs1433224653 111 dbSNP
rs1357648711 112 dbSNP
rs1314465553 116 dbSNP
rs1448509420 118 dbSNP
rs1344492447 119 dbSNP
rs1156842287 122 dbSNP
rs1401880520 124 dbSNP
rs573714948 127 dbSNP
rs1022831389 128 dbSNP
rs1474002496 132 dbSNP
rs1005375385 135 dbSNP
rs1182766242 137 dbSNP
rs1491542509 137 dbSNP
rs1491462675 138 dbSNP
rs1391275168 141 dbSNP
rs1326945243 148 dbSNP
rs540658996 152 dbSNP
rs376939375 154 dbSNP
rs756927677 158 dbSNP
rs1272594567 159 dbSNP
rs1231584626 161 dbSNP
rs923950459 167 dbSNP
rs1001883961 173 dbSNP
rs1228607447 176 dbSNP
rs1803119 180 dbSNP
rs955582331 185 dbSNP
rs1034713911 186 dbSNP
rs1049498 186 dbSNP
rs1389335436 186 dbSNP
rs3189662 187 dbSNP
rs987929416 196 dbSNP
rs185469522 202 dbSNP
rs1419489100 206 dbSNP
rs561523887 210 dbSNP
rs1338690446 212 dbSNP
rs1427621314 217 dbSNP
rs546055483 217 dbSNP
rs1417809810 220 dbSNP
rs913647663 224 dbSNP
rs564462170 236 dbSNP
rs780926903 239 dbSNP
rs967960316 253 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000557054.1 | 3UTR | cggcagugaucacuguccuaucacccuauaccuagcacugugaCACCACCCCUAAAUCACUUUGAGCCUGGGAAAUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.997 0.02 -1.000 0.5 3 Click to see details
BRCA -0.928 0.12 -1.000 0.5 3 Click to see details
HNSC 0.247 0.3 0.036 0.47 7 Click to see details
UCEC -0.546 0.32 -0.500 0.33 3 Click to see details
UCEC -0.546 0.32 -0.500 0.33 3 Click to see details
UCEC -0.546 0.32 -0.500 0.33 3 Click to see details
UCEC -0.546 0.32 -0.500 0.33 3 Click to see details
UCEC -0.546 0.32 -0.500 0.33 3 Click to see details
109 hsa-miR-1245a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006574 BRCA2 BRCA2, DNA repair associated 2 1
MIRT055432 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT063879 RASSF8 Ras association domain family member 8 2 6
MIRT077025 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT095775 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT099172 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT175616 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT456518 LYPLAL1 lysophospholipase like 1 2 2
MIRT464457 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465747 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT468257 SFXN4 sideroflexin 4 2 2
MIRT469216 RICTOR RPTOR independent companion of MTOR complex 2 2 2
MIRT472045 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT481795 APEX1 apurinic/apyrimidinic endodeoxyribonuclease 1 2 2
MIRT500154 CREBBP CREB binding protein 2 2
MIRT506514 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT506915 KBTBD8 kelch repeat and BTB domain containing 8 2 6
MIRT513901 GRB10 growth factor receptor bound protein 10 2 6
MIRT519128 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 2 2
MIRT528121 FOXH1 forkhead box H1 2 2
MIRT528942 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT540580 CEP89 centrosomal protein 89 2 2
MIRT545858 ZNF264 zinc finger protein 264 2 4
MIRT547147 PGM3 phosphoglucomutase 3 2 2
MIRT547434 MED4 mediator complex subunit 4 2 2
MIRT554650 ROBO1 roundabout guidance receptor 1 2 2
MIRT558524 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT559762 ABHD5 abhydrolase domain containing 5 2 2
MIRT560438 GOLGA7B golgin A7 family member B 2 2
MIRT561974 LRRC59 leucine rich repeat containing 59 2 2
MIRT562442 DDIT4 DNA damage inducible transcript 4 2 2
MIRT563489 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT568265 BMP2K BMP2 inducible kinase 2 2
MIRT572522 KIAA0232 KIAA0232 2 2
MIRT612801 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT621533 ZNF507 zinc finger protein 507 2 2
MIRT625205 GSTCD glutathione S-transferase C-terminal domain containing 2 2
MIRT625615 ZNF84 zinc finger protein 84 2 2
MIRT629215 C12orf66 chromosome 12 open reading frame 66 2 2
MIRT629509 AS3MT arsenite methyltransferase 2 2
MIRT629769 STK25 serine/threonine kinase 25 2 2
MIRT630908 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT632508 RAB13 RAB13, member RAS oncogene family 2 2
MIRT636871 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637106 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT637332 FAM9B family with sequence similarity 9 member B 2 2
MIRT637553 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT637639 ZNF431 zinc finger protein 431 2 2
MIRT637836 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT638326 RNF11 ring finger protein 11 2 2
MIRT638393 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642450 CLUAP1 clusterin associated protein 1 2 2
MIRT642616 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643133 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644324 NFKBID NFKB inhibitor delta 2 2
MIRT645150 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 2
MIRT645673 ADK adenosine kinase 2 2
MIRT646091 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT646858 SLC35E4 solute carrier family 35 member E4 2 2
MIRT650153 ZNF426 zinc finger protein 426 2 2
MIRT652483 TMEM181 transmembrane protein 181 2 2
MIRT653790 SIRPA signal regulatory protein alpha 2 2
MIRT655526 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT657077 JPH2 junctophilin 2 2 2
MIRT657322 HOOK3 hook microtubule tethering protein 3 2 2
MIRT662036 FUT2 fucosyltransferase 2 2 2
MIRT662322 ADM2 adrenomedullin 2 2 2
MIRT663211 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT663559 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663937 ZNF554 zinc finger protein 554 2 2
MIRT664689 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT664709 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT665291 ZFP14 ZFP14 zinc finger protein 2 2
MIRT665572 TXNL1 thioredoxin like 1 2 2
MIRT667068 PAOX polyamine oxidase 2 2
MIRT667304 MYO5A myosin VA 2 2
MIRT667442 METTL14 methyltransferase like 14 2 2
MIRT668048 GTPBP10 GTP binding protein 10 2 2
MIRT669604 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT671088 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT674361 SLC35E3 solute carrier family 35 member E3 2 2
MIRT674962 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT676394 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676819 AGMAT agmatinase 2 2
MIRT676891 ENSA endosulfine alpha 2 2
MIRT677059 ZNF34 zinc finger protein 34 2 2
MIRT678424 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678735 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT678930 XPOT exportin for tRNA 2 2
MIRT678954 MYADM myeloid associated differentiation marker 2 2
MIRT679228 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679765 TLR6 toll like receptor 6 2 2
MIRT681992 HRH4 histamine receptor H4 2 2
MIRT687405 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 2
MIRT694570 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT698449 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT706406 HAS2 hyaluronan synthase 2 2 2
MIRT706582 ZNF432 zinc finger protein 432 2 2
MIRT706838 VHLL VHL like 2 2
MIRT706909 DVL3 dishevelled segment polarity protein 3 2 2
MIRT707052 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT708583 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT708988 CABP4 calcium binding protein 4 2 2
MIRT713041 ADRA2B adrenoceptor alpha 2B 2 2
MIRT713731 SUCO SUN domain containing ossification factor 2 2
MIRT714968 RAB21 RAB21, member RAS oncogene family 2 2
MIRT717485 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT722826 KLK2 kallikrein related peptidase 2 2 2
MIRT723305 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1245a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-1245a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-1245a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1245a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1245a Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-1245a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission