miRTarBase - #MIRT482405


—
pre-miRNA Information
pre-miRNA hsa-mir-6769b   
Genomic Coordinates chr1: 206474803 - 206474864
Description Homo sapiens miR-6769b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6769b-3p
Sequence 42| CCCUCUCUGUCCCACCCAUAG |62
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN26671848 9 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs555627187 3 dbSNP
rs782102173 4 dbSNP
rs201952639 7 dbSNP
rs782001154 9 dbSNP
rs1488064450 15 dbSNP
rs782111367 16 dbSNP
rs370859899 18 dbSNP
rs1305197911 19 dbSNP
Putative Targets

Gene Information
Gene Symbol ADRB1   
Synonyms ADRB1R, B1AR, BETA1AR, RHR
Description adrenoceptor beta 1
Transcript NM_000684   
Expression
Putative miRNA Targets on ADRB1
3'UTR of ADRB1
(miRNA target sites are highlighted)		 
>ADRB1|NM_000684|3'UTR
   1 GGCCCGGCGCGGGGCGCGGACTCCGGGCACGGCTTCCCAGGGGAACGAGGAGATCTGTGTTTACTTAAGACCGATAGCAG
  81 GTGAACTCGAAGCCCACAATCCTCGTCTGAATCATCCGAGGCAAAGAGAAAAGCCACGGACCGTTGCACAAAAAGGAAAG
 161 TTTGGGAAGGGATGGGAGAGTGGCTTGCTGATGTTCCTTGTTGTTTTTTTTTTCTTTTCTTTTCTTTCTTCTTCTTTTTT
 241 TTTTTTTTTTTTTTTTCTGTTTGTGGTCCGGCCTTCTTTTGTGTGTGCGTGTGATGCATCTTTAGATTTTTTTCCCCCAC
 321 CAGGTGGTTTTTGACACTCTCTGAGAGGACCGGAGTGGAAGATGGGTGGGTTAGGGGAAGGGAGAAGCATTAGGAGGGGA
 401 TTAAAATCGATCATCGTGGCTCCCATCCCTTTCCCGGGAACAGGAACACACTACCAGCCAGAGAGAGGAGAATGACAGTT
 481 TGTCAAGACATATTTCCTTTTGCTTTCCAGAGAAATTTCATTTTAATTTCTAAGTAATGATTTCTGCTGTTATGAAAGCA
 561 AAGAGAAAGGATGGAGGCAAAATAAAAAAAAATCACGTTTCAAGAAATGTTAAGCTCTTCTTGGAACAAGCCCCACCTTG
 641 CTTTCCTTGTGTAGGGCAAACCCGCTGTCCCCCGCGCGCCTGGGTGGTCAGGCTGAGGGATTTCTACCTCACACTGTGCA
 721 TTTGCACAGCAGATAGAAAGACTTGTTTATATTAAACAGCTTATTTATGTATCAATATTAGTTGGAAGGACCAGGCGCAG
 801 AGCCTCTCTCTGTGACATGTGACTCTGTCAATTGAAGACAGGACATTAAAAGAGAGCGAGAGAGAGAAACAGTTCAGATT
 881 ACTGCACATGTGGATAAAAACAAAAACAAAAAAAAGGAGTGGTTCAAAATGCCATTTTTGCACAGTGTTAGGAATTACAA
 961 AATCCACAGAAGATGTTACTTGCACAAAAAGAAATTAAATATTTTTTAAAGGGAGAGGGGCTGGGCAGATCTTAAATAAA
1041 ATTCAAACTCTACTTCTGTTGTCTAGTATGTTATTGAGCTAATGATTCATTGGGAAAATACCTTTTTATACTCCTTTATC
1121 ATGGTACTGTAACTGTATCCATATTATAAATATAATTATCTTAAGGATTTTTTATTTTTTTTTATGTCCAAGTGCCCACG
1201 TGAATTTGCTGGTGAAAGTTAGCACTTGTGTGTAAATTCTACTTCCTCTTGTGTGTTTTACCAAGTATTTATACTCTGGT
1281 GCAACTAACTACTGTGTGAGGAATTGGTCCATGTGCAATAAATACCAATGAAGCACAATCAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gauacccacccUGUCUCUCCc 5'
                     | ||||||| 
Target 5' cactaccagccAGAGAGAGGa 3'
 449 - 469 142.00 -14.00
2 
miRNA  3' gaUACCCACCCUGUCUCUCcc 5'
            | | | | || ||||||  
Target 5' aaAAGAGAGCGAGAGAGAGaa 3'
 848 - 868 135.00 -9.40
3 
miRNA  3' gaUACCCA--CCCUGUCUCUCcc 5'
            :|||||  |||: ||:|||  
Target 5' ggGTGGGTTAGGGGAAGGGAGaa 3'
 364 - 386 133.00 -25.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26557528 28 COSMIC
COSN23521720 70 COSMIC
COSN23012256 213 COSMIC
COSN8639071 220 COSMIC
COSN20092222 225 COSMIC
COSN8639072 229 COSMIC
COSN30114522 230 COSMIC
COSN8639073 232 COSMIC
COSN20107569 234 COSMIC
COSN19661071 235 COSMIC
COSN31561863 246 COSMIC
COSN26448585 258 COSMIC
COSN31540500 270 COSMIC
COSN26583699 301 COSMIC
COSN31577542 305 COSMIC
COSN15623069 428 COSMIC
COSN15623070 434 COSMIC
COSN28395988 445 COSMIC
COSN28690465 456 COSMIC
COSN31585539 513 COSMIC
COSN8530140 571 COSMIC
COSN27471850 593 COSMIC
COSN30127881 609 COSMIC
COSN24549279 663 COSMIC
COSN30143441 719 COSMIC
COSN31527645 755 COSMIC
COSN30142198 867 COSMIC
COSN8639074 886 COSMIC
COSN26645446 902 COSMIC
COSN4711487 903 COSMIC
COSN20107570 916 COSMIC
COSN26603179 932 COSMIC
COSN30144319 994 COSMIC
COSN15253789 1012 COSMIC
COSN30128378 1015 COSMIC
COSN15623071 1084 COSMIC
COSN31512968 1137 COSMIC
COSN29607110 1184 COSMIC
COSN30137464 1184 COSMIC
COSN8530141 1227 COSMIC
COSN15806649 1235 COSMIC
COSN28691793 1264 COSMIC
COSN8639075 1264 COSMIC
COSN26636270 1307 COSMIC
COSN8530142 1338 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs769501937 3 dbSNP
rs929679913 6 dbSNP
rs1045877135 7 dbSNP
rs55637433 9 dbSNP
rs1158456706 10 dbSNP
rs1168366344 15 dbSNP
rs372627850 19 dbSNP
rs1373138139 25 dbSNP
rs1444058324 25 dbSNP
rs1421654909 26 dbSNP
rs1330108068 27 dbSNP
rs531424891 28 dbSNP
rs1455512103 34 dbSNP
rs1034477323 44 dbSNP
rs1320694809 47 dbSNP
rs1444371749 47 dbSNP
rs1299063069 48 dbSNP
rs1244208586 49 dbSNP
rs171169 56 dbSNP
rs1020980658 64 dbSNP
rs238739 65 dbSNP
rs367663132 73 dbSNP
rs1177552375 74 dbSNP
rs549910518 76 dbSNP
rs576302800 80 dbSNP
rs893322328 83 dbSNP
rs1455186119 96 dbSNP
rs1397171755 100 dbSNP
rs1173913038 105 dbSNP
rs1162100421 106 dbSNP
rs1455888314 115 dbSNP
rs1358533969 118 dbSNP
rs968069097 122 dbSNP
rs1011812170 135 dbSNP
rs1001255106 137 dbSNP
rs1017893920 138 dbSNP
rs1177235760 139 dbSNP
rs1299677232 145 dbSNP
rs1274383704 150 dbSNP
rs1209793337 151 dbSNP
rs1354254716 160 dbSNP
rs1397765925 167 dbSNP
rs965322008 173 dbSNP
rs1246967819 174 dbSNP
rs1376524612 176 dbSNP
rs1304421126 185 dbSNP
rs1042278835 188 dbSNP
rs903314417 197 dbSNP
rs1306766170 198 dbSNP
rs967770830 198 dbSNP
rs1188185539 204 dbSNP
rs1378141459 204 dbSNP
rs35435446 204 dbSNP
rs79674809 204 dbSNP
rs78006160 205 dbSNP
rs571235765 207 dbSNP
rs1233821780 208 dbSNP
rs1300631389 209 dbSNP
rs1271134238 210 dbSNP
rs1450450278 210 dbSNP
rs538272097 210 dbSNP
rs1230187322 211 dbSNP
rs1256569745 212 dbSNP
rs1457599638 214 dbSNP
rs11196607 215 dbSNP
rs1030830591 218 dbSNP
rs756675746 220 dbSNP
rs1469499306 223 dbSNP
rs1188971258 224 dbSNP
rs1347394374 224 dbSNP
rs377360766 225 dbSNP
rs1173848100 226 dbSNP
rs376858529 228 dbSNP
rs759439420 228 dbSNP
rs1299609828 229 dbSNP
rs878910373 229 dbSNP
rs1172439881 230 dbSNP
rs1200805178 232 dbSNP
rs1217308293 232 dbSNP
rs1218148560 232 dbSNP
rs1261126672 232 dbSNP
rs1277653355 232 dbSNP
rs1400945012 232 dbSNP
rs1431042104 232 dbSNP
rs879089504 232 dbSNP
rs953426123 232 dbSNP
rs1325565616 233 dbSNP
rs1421283464 233 dbSNP
rs1464886734 234 dbSNP
rs113352788 235 dbSNP
rs1177694478 235 dbSNP
rs1188429398 235 dbSNP
rs1208313166 235 dbSNP
rs1237170172 235 dbSNP
rs1337691616 235 dbSNP
rs1408795043 235 dbSNP
rs1413072592 235 dbSNP
rs1421562173 235 dbSNP
rs1462456132 235 dbSNP
rs1475848641 235 dbSNP
rs1477790676 235 dbSNP
rs565492565 235 dbSNP
rs1326878189 237 dbSNP
rs1397001522 238 dbSNP
rs986189305 239 dbSNP
rs1434521493 240 dbSNP
rs1293029750 242 dbSNP
rs1362675632 243 dbSNP
rs1214695040 250 dbSNP
rs1384493887 253 dbSNP
rs1276845583 254 dbSNP
rs1317749085 255 dbSNP
rs1343794328 257 dbSNP
rs1385361303 257 dbSNP
rs1454246783 257 dbSNP
rs74383431 258 dbSNP
rs1275384028 259 dbSNP
rs762046420 260 dbSNP
rs1218833041 262 dbSNP
rs1289897864 263 dbSNP
rs1245691940 264 dbSNP
rs71484919 265 dbSNP
rs1485901060 266 dbSNP
rs1195819293 268 dbSNP
rs1413207787 270 dbSNP
rs1260892660 276 dbSNP
rs1477432930 277 dbSNP
rs1165409174 282 dbSNP
rs911024483 283 dbSNP
rs1419687148 284 dbSNP
rs1243523376 286 dbSNP
rs1403818734 289 dbSNP
rs553764218 290 dbSNP
rs1252948109 295 dbSNP
rs1205169418 297 dbSNP
rs1320517430 298 dbSNP
rs190324624 304 dbSNP
rs1247704937 305 dbSNP
rs1345927185 307 dbSNP
rs1403129289 307 dbSNP
rs974377824 308 dbSNP
rs918538597 314 dbSNP
rs1432953517 316 dbSNP
rs1300376047 318 dbSNP
rs1443571095 321 dbSNP
rs536598478 328 dbSNP
rs1161821988 337 dbSNP
rs976283121 340 dbSNP
rs1386147875 342 dbSNP
rs143711992 345 dbSNP
rs537352253 352 dbSNP
rs1252406100 353 dbSNP
rs1177653438 357 dbSNP
rs906866216 358 dbSNP
rs1415871264 367 dbSNP
rs1244474216 368 dbSNP
rs983133205 383 dbSNP
rs773382869 388 dbSNP
rs1055571158 396 dbSNP
rs1284810679 398 dbSNP
rs182255881 400 dbSNP
rs556258658 401 dbSNP
rs1315435362 403 dbSNP
rs1309624263 408 dbSNP
rs17875477 409 dbSNP
rs1020949892 414 dbSNP
rs903476074 417 dbSNP
rs1406794233 427 dbSNP
rs1317029819 436 dbSNP
rs1044447402 437 dbSNP
rs927243009 442 dbSNP
rs1451909572 445 dbSNP
rs998182081 447 dbSNP
rs1159652033 448 dbSNP
rs1218205446 449 dbSNP
rs1432497990 453 dbSNP
rs1427180416 460 dbSNP
rs938559663 462 dbSNP
rs1283203590 465 dbSNP
rs1056984643 470 dbSNP
rs953390277 474 dbSNP
rs986153373 477 dbSNP
rs1047284 479 dbSNP
rs766431899 486 dbSNP
rs1486676709 490 dbSNP
rs1262831890 491 dbSNP
rs1239057795 502 dbSNP
rs1471682831 509 dbSNP
rs891606783 522 dbSNP
rs945849620 549 dbSNP
rs962502770 550 dbSNP
rs1346163569 552 dbSNP
rs1283368126 554 dbSNP
rs1277708251 556 dbSNP
rs1387469407 584 dbSNP
rs200145649 584 dbSNP
rs918496522 585 dbSNP
rs1465321586 590 dbSNP
rs545055575 591 dbSNP
rs79955839 593 dbSNP
rs929870262 594 dbSNP
rs981773034 598 dbSNP
rs370624279 610 dbSNP
rs1042519047 616 dbSNP
rs1435956445 622 dbSNP
rs903935374 625 dbSNP
rs560562465 628 dbSNP
rs1261937515 632 dbSNP
rs1000906238 633 dbSNP
rs1461095666 637 dbSNP
rs1261672788 638 dbSNP
rs572645587 655 dbSNP
rs1206105440 662 dbSNP
rs1017987082 664 dbSNP
rs1257474164 665 dbSNP
rs900754945 670 dbSNP
rs937014803 671 dbSNP
rs1055541411 672 dbSNP
rs1296519650 673 dbSNP
rs774689147 674 dbSNP
rs1280462213 677 dbSNP
rs1373635535 678 dbSNP
rs1030468118 679 dbSNP
rs774697088 684 dbSNP
rs1306460858 685 dbSNP
rs3177559 699 dbSNP
rs1211586756 700 dbSNP
rs950910403 701 dbSNP
rs1166107434 708 dbSNP
rs1463035428 715 dbSNP
rs1280627970 719 dbSNP
rs1440528725 721 dbSNP
rs1186326777 736 dbSNP
rs947540749 737 dbSNP
rs543381634 743 dbSNP
rs1233183206 744 dbSNP
rs983583184 752 dbSNP
rs1041852522 758 dbSNP
rs1462141946 760 dbSNP
rs903360757 761 dbSNP
rs965206565 771 dbSNP
rs977003328 772 dbSNP
rs1251981127 781 dbSNP
rs561425498 790 dbSNP
rs889094925 795 dbSNP
rs759995369 797 dbSNP
rs1454746519 798 dbSNP
rs1326694213 803 dbSNP
rs1393077232 804 dbSNP
rs1396571487 823 dbSNP
rs1174868053 831 dbSNP
rs1016292431 832 dbSNP
rs1422325493 833 dbSNP
rs1386760725 835 dbSNP
rs1400729649 843 dbSNP
rs926928329 844 dbSNP
rs938626468 848 dbSNP
rs963468443 852 dbSNP
rs1180213796 858 dbSNP
rs1414354520 858 dbSNP
rs1329987489 859 dbSNP
rs992773206 864 dbSNP
rs1221897289 868 dbSNP
rs759661825 871 dbSNP
rs1294170669 872 dbSNP
rs945900605 873 dbSNP
rs1448622369 886 dbSNP
rs1328858962 888 dbSNP
rs1246994211 890 dbSNP
rs1349610626 894 dbSNP
rs1375586492 896 dbSNP
rs1234346888 902 dbSNP
rs1241088848 904 dbSNP
rs1276069985 904 dbSNP
rs772588440 906 dbSNP
rs2210096 907 dbSNP
rs1336315111 908 dbSNP
rs1366935355 908 dbSNP
rs1402503293 908 dbSNP
rs17875446 908 dbSNP
rs397844146 908 dbSNP
rs531964931 912 dbSNP
rs199866231 917 dbSNP
rs1418733226 918 dbSNP
rs1407699563 923 dbSNP
rs1157261850 946 dbSNP
rs1471425123 948 dbSNP
rs1364931010 957 dbSNP
rs1199364277 959 dbSNP
rs1218504392 962 dbSNP
rs564813512 963 dbSNP
rs1223480393 964 dbSNP
rs936710174 968 dbSNP
rs1197038478 972 dbSNP
rs1206721294 985 dbSNP
rs1237766590 990 dbSNP
rs1282519696 992 dbSNP
rs1221620777 1002 dbSNP
rs1469042850 1004 dbSNP
rs1346789892 1019 dbSNP
rs1039050983 1021 dbSNP
rs761688323 1026 dbSNP
rs900471394 1026 dbSNP
rs1375943400 1033 dbSNP
rs1343113889 1044 dbSNP
rs1316654061 1048 dbSNP
rs764952506 1051 dbSNP
rs1386139630 1053 dbSNP
rs997512427 1054 dbSNP
rs1431532407 1059 dbSNP
rs1426308717 1062 dbSNP
rs1030581189 1063 dbSNP
rs1168151432 1069 dbSNP
rs1399136445 1074 dbSNP
rs1441126726 1075 dbSNP
rs879320595 1079 dbSNP
rs1195643775 1081 dbSNP
rs886685882 1082 dbSNP
rs1005017684 1090 dbSNP
rs1262298459 1091 dbSNP
rs1201680424 1093 dbSNP
rs1325666960 1094 dbSNP
rs1263185665 1096 dbSNP
rs1213531993 1111 dbSNP
rs928566682 1112 dbSNP
rs1271505182 1122 dbSNP
rs1324957391 1123 dbSNP
rs1366360664 1124 dbSNP
rs1336561656 1128 dbSNP
rs1468667073 1129 dbSNP
rs1409000422 1135 dbSNP
rs1016349792 1154 dbSNP
rs1328841110 1155 dbSNP
rs1409413587 1165 dbSNP
rs187312072 1167 dbSNP
rs1435740212 1168 dbSNP
rs17875447 1174 dbSNP
rs914245365 1175 dbSNP
rs991194045 1175 dbSNP
rs1319781205 1182 dbSNP
rs980231008 1184 dbSNP
rs1462580292 1185 dbSNP
rs1243630918 1192 dbSNP
rs1203737193 1196 dbSNP
rs947125471 1200 dbSNP
rs1274572932 1201 dbSNP
rs1034090782 1203 dbSNP
rs959999285 1219 dbSNP
rs1358331778 1229 dbSNP
rs1335744724 1231 dbSNP
rs1450844244 1239 dbSNP
rs560742694 1247 dbSNP
rs1211792581 1258 dbSNP
rs1303872578 1270 dbSNP
rs1442139153 1271 dbSNP
rs1041872487 1280 dbSNP
rs1265441265 1283 dbSNP
rs1270413226 1295 dbSNP
rs992490546 1302 dbSNP
rs1430609992 1314 dbSNP
rs1384902778 1324 dbSNP
rs1194584763 1329 dbSNP
rs933506438 1337 dbSNP
rs1265940030 1338 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 153.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 153.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 153.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177602. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_4 PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7 PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177607. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_9 PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10 PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11 PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177614. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_4 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7 PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10 PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11 PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 PAR-CLIP data was present in ERX177626. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_4 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 PAR-CLIP data was present in ERX177631. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_9 PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10 PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11 PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12 PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000369295.2 | 3UTR | CUGAGAGGACCGGAGUGGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000369295.2 | 3UTR | CUGAGAGGACCGGAGUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000369295.2 | 3UTR | CUGAGAGGACCGGAGUGGAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000369295.2 | 3UTR | UCUGAGAGGACCGGAGUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000369295.2 | 3UTR | UCUGAGAGGACCGGAGUGGAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000369295.2 | 3UTR | UCUGAGAGGACCGGAGUGGAAGAUGGGUGGGUUAGGGGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000369295.2 | 3UTR | UCUGAGAGGACCGGAGUGGAAGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000369295.2 | 3UTR | UCUGAGAGGACCGGAGUGGAAGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000369295.2 | 3UTR | UCUGAGAGGACCGGAGUGGAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
209 hsa-miR-6769b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT181753 UHMK1 U2AF homology motif kinase 1 2 2
MIRT287119 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT395372 CDC42EP4 CDC42 effector protein 4 2 4
MIRT472533 NACC1 nucleus accumbens associated 1 2 4
MIRT472611 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT482405 ADRB1 adrenoceptor beta 1 2 10
MIRT492330 SETD1B SET domain containing 1B 2 2
MIRT499238 VAV3 vav guanine nucleotide exchange factor 3 2 6
MIRT512274 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT534548 RUNX1 runt related transcription factor 1 2 2
MIRT535374 PEX5L peroxisomal biogenesis factor 5 like 2 2
MIRT535424 PDZD8 PDZ domain containing 8 2 2
MIRT539329 AHSA2 activator of HSP90 ATPase homolog 2 2 4
MIRT569350 EFHC1 EF-hand domain containing 1 2 2
MIRT576116 Klf6 Kruppel-like factor 6 2 2
MIRT607241 LINS lines homolog 1 2 4
MIRT607364 ASAH2 N-acylsphingosine amidohydrolase 2 2 4
MIRT609572 CATSPER4 cation channel sperm associated 4 2 2
MIRT610045 SERPINA3 serpin family A member 3 2 2
MIRT610284 PLCXD3 phosphatidylinositol specific phospholipase C X domain containing 3 2 2
MIRT610302 KLHL21 kelch like family member 21 2 2
MIRT610393 FOXE1 forkhead box E1 2 2
MIRT610432 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT610510 BARHL2 BarH like homeobox 2 2 2
MIRT611818 FCRL4 Fc receptor like 4 2 2
MIRT612755 MYOCD myocardin 2 2
MIRT613698 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613917 POU3F1 POU class 3 homeobox 1 2 2
MIRT615153 URGCP-MRPS24 URGCP-MRPS24 readthrough 2 2
MIRT615201 CLUAP1 clusterin associated protein 1 2 2
MIRT615338 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT616706 UBXN2A UBX domain protein 2A 2 2
MIRT617186 GOSR2 golgi SNAP receptor complex member 2 2 4
MIRT617526 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT617596 NUDT5 nudix hydrolase 5 2 4
MIRT617763 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT618613 SHOX short stature homeobox 2 2
MIRT619301 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT619515 TXLNB taxilin beta 2 2
MIRT619925 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT619942 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT620025 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT620554 C10orf10 chromosome 10 open reading frame 10 2 4
MIRT620752 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT621798 TMEM233 transmembrane protein 233 2 2
MIRT621843 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT622693 PLSCR1 phospholipid scramblase 1 2 2
MIRT622733 PITPNM3 PITPNM family member 3 2 2
MIRT623004 ONECUT3 one cut homeobox 3 2 2
MIRT623211 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT623771 GPR37L1 G protein-coupled receptor 37 like 1 2 2
MIRT624119 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT624150 DIAPH1 diaphanous related formin 1 2 2
MIRT624443 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT624855 ABI2 abl interactor 2 2 2
MIRT625311 SHISA6 shisa family member 6 2 2
MIRT625741 MTSS1 MTSS1, I-BAR domain containing 2 2
MIRT626292 ZNF85 zinc finger protein 85 2 2
MIRT627400 TMEM170A transmembrane protein 170A 2 2
MIRT627464 SYNRG synergin gamma 2 2
MIRT627913 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT636508 GDAP1L1 ganglioside induced differentiation associated protein 1 like 1 2 2
MIRT636910 KIAA0408 KIAA0408 2 2
MIRT637302 ACTN2 actinin alpha 2 2 2
MIRT638230 SOGA3 SOGA family member 3 2 2
MIRT639880 STC1 stanniocalcin 1 2 2
MIRT639999 PHF21B PHD finger protein 21B 2 2
MIRT640149 CEP104 centrosomal protein 104 2 2
MIRT640699 SKI SKI proto-oncogene 2 2
MIRT640911 RAB13 RAB13, member RAS oncogene family 2 2
MIRT641518 CREBBP CREB binding protein 2 2
MIRT641990 OXSR1 oxidative stress responsive 1 2 2
MIRT642635 EPPIN epididymal peptidase inhibitor 2 2
MIRT642744 TDRD6 tudor domain containing 6 2 2
MIRT642759 SDHAF2 succinate dehydrogenase complex assembly factor 2 2 2
MIRT642787 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 2 2
MIRT643054 EPPIN-WFDC6 EPPIN-WFDC6 readthrough 2 2
MIRT643104 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT643316 TMEM151B transmembrane protein 151B 2 2
MIRT643715 ITK IL2 inducible T-cell kinase 2 2
MIRT644087 A4GALT alpha 1,4-galactosyltransferase (P blood group) 2 2
MIRT644112 SEL1L3 SEL1L family member 3 2 2
MIRT644377 ZNF286A zinc finger protein 286A 2 2
MIRT644408 FRMD6 FERM domain containing 6 2 2
MIRT644684 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT644744 CCDC174 coiled-coil domain containing 174 2 2
MIRT644876 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT645417 FAM110A family with sequence similarity 110 member A 2 2
MIRT645928 PLXNA3 plexin A3 2 2
MIRT646181 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT646554 TMCC2 transmembrane and coiled-coil domain family 2 2 2
MIRT647235 OR6A2 olfactory receptor family 6 subfamily A member 2 2 2
MIRT647263 PTGDR2 prostaglandin D2 receptor 2 2 2
MIRT647660 FOXL1 forkhead box L1 2 2
MIRT648284 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT648493 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT648963 TMEM45B transmembrane protein 45B 2 2
MIRT649511 RAB17 RAB17, member RAS oncogene family 2 2
MIRT650446 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650712 KRT32 keratin 32 2 2
MIRT651069 ZNF518B zinc finger protein 518B 2 4
MIRT651090 ZNF516 zinc finger protein 516 2 2
MIRT651193 ZNF281 zinc finger protein 281 2 2
MIRT651330 ZCCHC2 zinc finger CCHC-type containing 2 2 2
MIRT651445 XKR4 XK related 4 2 2
MIRT651517 WNT4 Wnt family member 4 2 4
MIRT651694 VPS13D vacuolar protein sorting 13 homolog D 2 2
MIRT652173 TRIM66 tripartite motif containing 66 2 2
MIRT652432 TMEM239 transmembrane protein 239 2 2
MIRT652656 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT652707 THBS2 thrombospondin 2 2 2
MIRT652812 TBL2 transducin beta like 2 2 2
MIRT653350 SMG7 SMG7, nonsense mediated mRNA decay factor 2 2
MIRT653471 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT653658 SLC27A4 solute carrier family 27 member 4 2 2
MIRT654691 PSMB5 proteasome subunit beta 5 2 2
MIRT654735 PRLR prolactin receptor 2 2
MIRT654931 POLR3D RNA polymerase III subunit D 2 2
MIRT655209 PHAX phosphorylated adaptor for RNA export 2 2
MIRT655346 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT655404 PANK1 pantothenate kinase 1 2 2
MIRT655482 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT655964 NDNF neuron derived neurotrophic factor 2 2
MIRT656017 MYPN myopalladin 2 2
MIRT656491 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT657151 ITGA1 integrin subunit alpha 1 2 2
MIRT657411 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT657608 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT658181 FBXO9 F-box protein 9 2 2
MIRT658932 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT659028 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659092 DENR density regulated re-initiation and release factor 2 2
MIRT659204 CYBB cytochrome b-245 beta chain 2 2
MIRT659718 CCDC93 coiled-coil domain containing 93 2 2
MIRT660185 BNC2 basonuclin 2 2 2
MIRT660805 AIFM2 apoptosis inducing factor, mitochondria associated 2 2 2
MIRT660900 ADCY6 adenylate cyclase 6 2 2
MIRT660925 ADAM19 ADAM metallopeptidase domain 19 2 2
MIRT661741 DTHD1 death domain containing 1 2 2
MIRT661998 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT662639 PKHD1L1 PKHD1 like 1 2 2
MIRT664338 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT666743 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT667070 PANK3 pantothenate kinase 3 2 2
MIRT667925 IGLON5 IgLON family member 5 2 2
MIRT668488 ETV3 ETS variant 3 2 2
MIRT668610 EHD4 EH domain containing 4 2 2
MIRT669419 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT669652 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT674005 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT680447 SLCO5A1 solute carrier organic anion transporter family member 5A1 2 2
MIRT684326 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT685625 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT689978 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT693962 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT698543 TFRC transferrin receptor 2 2
MIRT699982 RREB1 ras responsive element binding protein 1 2 2
MIRT702898 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT707383 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT708312 CDH8 cadherin 8 2 2
MIRT708406 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT709299 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT710326 STK40 serine/threonine kinase 40 2 2
MIRT710729 C19orf68 zinc finger SWIM-type containing 9 2 2
MIRT710970 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT711178 EMCN endomucin 2 2
MIRT711590 SETD1A SET domain containing 1A 2 2
MIRT711611 LHX5 LIM homeobox 5 2 2
MIRT711701 GMPR guanosine monophosphate reductase 2 2
MIRT711850 AMOTL2 angiomotin like 2 2 2
MIRT712358 NAT14 N-acetyltransferase 14 (putative) 2 2
MIRT712377 MTPN myotrophin 2 2
MIRT712469 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT712839 RHOA ras homolog family member A 2 2
MIRT713592 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT713982 ASIC4 acid sensing ion channel subunit family member 4 2 2
MIRT714534 ZBTB39 zinc finger and BTB domain containing 39 2 2
MIRT714570 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 2 2
MIRT714610 EXO5 exonuclease 5 2 2
MIRT714943 ZNF330 zinc finger protein 330 2 2
MIRT715132 ACADL acyl-CoA dehydrogenase, long chain 2 2
MIRT716018 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT716204 TYW3 tRNA-yW synthesizing protein 3 homolog 2 2
MIRT716674 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT717366 EDN2 endothelin 2 2 2
MIRT718110 CRTC1 CREB regulated transcription coactivator 1 2 2
MIRT718502 GYS1 glycogen synthase 1 2 2
MIRT719146 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719415 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT719986 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT720347 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT720452 SLC16A5 solute carrier family 16 member 5 2 2
MIRT720493 TMEM178B transmembrane protein 178B 2 2
MIRT720666 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT721091 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT721334 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT721384 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT721508 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT721827 POU6F1 POU class 6 homeobox 1 2 2
MIRT722136 TTLL11 tubulin tyrosine ligase like 11 2 2
MIRT723070 GGA1 golgi associated, gamma adaptin ear containing, ARF binding protein 1 2 2
MIRT723115 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT723374 ZNF470 zinc finger protein 470 2 2
MIRT724446 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT724528 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT724643 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT724711 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT724750 ZNF391 zinc finger protein 391 2 2
MIRT724770 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6769b Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-6769b Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-miR-6769b-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-6769b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-6769b-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission