pre-miRNA Information
pre-miRNA hsa-mir-520a   
Genomic Coordinates chr19: 53690881 - 53690965
Description Homo sapiens miR-520a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-520a-5p
Sequence 15| CUCCAGAGGGAAGUACUUUCU |35
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1172516897 2 dbSNP
rs747333607 4 dbSNP
rs1186636488 5 dbSNP
rs1461358452 13 dbSNP
rs1238887108 14 dbSNP
rs1305652558 17 dbSNP
rs371672116 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPL18A   
Synonyms L18A
Description ribosomal protein L18a
Transcript NM_000980   
Expression
Putative miRNA Targets on RPL18A
3'UTR of RPL18A
(miRNA target sites are highlighted)
>RPL18A|NM_000980|3'UTR
   1 GTGCAGGGCCCTCGTCCGGGTGTGCCCCAAATAAACTCAGGAACGCCCCGGTGCTCGCCGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucuuUCAUGAAGGGAGACCUc 5'
              || :|  :| || ||: 
Target 5' gtgcAGGGCCCTCGTCCGGGt 3'
1 - 21 73.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13788350 18 COSMIC
COSN30145706 19 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759749405 2 dbSNP
rs538786021 3 dbSNP
rs544370575 4 dbSNP
rs765799680 5 dbSNP
rs1056964007 7 dbSNP
rs753092481 11 dbSNP
rs758915772 14 dbSNP
rs557843560 15 dbSNP
rs751633473 18 dbSNP
rs577673778 19 dbSNP
rs1471503298 20 dbSNP
rs1161023676 21 dbSNP
rs1412990880 22 dbSNP
rs781326882 23 dbSNP
rs749113586 25 dbSNP
rs768287543 31 dbSNP
rs1396631843 38 dbSNP
rs778751529 39 dbSNP
rs1349098364 43 dbSNP
rs190103815 45 dbSNP
rs1289364958 46 dbSNP
rs1334992978 48 dbSNP
rs1329515120 49 dbSNP
rs772044923 50 dbSNP
rs73020701 51 dbSNP
rs1040053773 55 dbSNP
rs1304970009 56 dbSNP
rs374679822 57 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucuuucaugaagggAGACCUc 5'
                        |||||| 
Target 5' -----------uagUCUGGAa 3'
1 - 10
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000600147.1 | 3UTR | UAGUCUGGAACUCGACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.607 8.3e-4 -0.609 7.9e-4 24 Click to see details
GSE28260 Renal cortex and medulla -0.748 1.6e-3 -0.681 5.2e-3 13 Click to see details
GSE32688 Pancreatic cancer 0.329 3.3e-2 0.496 1.9e-3 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.393 4.3e-2 0.681 4.7e-4 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.327 6.4e-2 -0.021 4.6e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.271 1.0e-1 -0.302 7.6e-2 24 Click to see details
GSE38226 Liver fibrosis 0.29 1.0e-1 0.581 2.9e-3 21 Click to see details
GSE19350 CNS germ cell tumors -0.254 2.1e-1 -0.133 3.4e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.09 2.4e-1 -0.039 3.8e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.086 3.4e-1 -0.170 2.1e-1 25 Click to see details
GSE21849 B cell lymphoma 0.078 3.4e-1 0.218 1.3e-1 29 Click to see details
GSE17306 Multiple myeloma -0.019 4.5e-1 0.392 2.7e-3 49 Click to see details
GSE17306 Multiple myeloma -0.019 4.5e-1 0.392 2.7e-3 49 Click to see details
GSE17306 Multiple myeloma -0.019 4.5e-1 0.392 2.7e-3 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.93 0.03 -0.600 0.2 4 Click to see details
LIHC -0.803 0.05 -0.700 0.09 5 Click to see details
BRCA 0.496 0.07 0.430 0.11 10 Click to see details
BLCA -0.8 0.1 -0.800 0.1 4 Click to see details
LUSC -0.692 0.15 -0.400 0.3 4 Click to see details
HNSC 0.04 0.46 -0.024 0.48 8 Click to see details
HNSC 0.04 0.46 -0.024 0.48 8 Click to see details
HNSC 0.04 0.46 -0.024 0.48 8 Click to see details
HNSC 0.04 0.46 -0.024 0.48 8 Click to see details
HNSC 0.04 0.46 -0.024 0.48 8 Click to see details
HNSC 0.04 0.46 -0.024 0.48 8 Click to see details
115 hsa-miR-520a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092732 SETD5 SET domain containing 5 2 4
MIRT168595 HMGA1 high mobility group AT-hook 1 2 4
MIRT232084 CCSAP centriole, cilia and spindle associated protein 2 2
MIRT252430 MIDN midnolin 2 4
MIRT294600 ZNF460 zinc finger protein 460 2 2
MIRT343114 IGF1R insulin like growth factor 1 receptor 2 2
MIRT441904 SEPN1 selenoprotein N 2 2
MIRT443233 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT446250 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT448001 GPR63 G protein-coupled receptor 63 2 2
MIRT451560 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT455285 BCL2L1 BCL2 like 1 2 2
MIRT456170 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT456679 LDB1 LIM domain binding 1 2 2
MIRT458206 FOXL2 forkhead box L2 2 2
MIRT461267 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT461683 ZNF426 zinc finger protein 426 2 2
MIRT462656 HMOX1 heme oxygenase 1 2 4
MIRT464368 URM1 ubiquitin related modifier 1 2 2
MIRT468138 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468234 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT470357 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT472039 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT475941 GXYLT1 glucoside xylosyltransferase 1 2 2
MIRT477880 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT480419 C17orf85 nuclear cap binding subunit 3 2 2
MIRT482642 RPL18A ribosomal protein L18a 2 2
MIRT485666 CDC25B cell division cycle 25B 2 2
MIRT485740 CALCR calcitonin receptor 2 2
MIRT488906 TSTD2 thiosulfate sulfurtransferase like domain containing 2 2 6
MIRT490412 NRXN3 neurexin 3 2 2
MIRT494726 ARHGAP1 Rho GTPase activating protein 1 2 6
MIRT495957 TBC1D19 TBC1 domain family member 19 2 2
MIRT498087 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT507449 EIF6 eukaryotic translation initiation factor 6 2 2
MIRT522992 INPP4A inositol polyphosphate-4-phosphatase type I A 2 4
MIRT526008 RBM4B RNA binding motif protein 4B 2 2
MIRT527693 IL17REL interleukin 17 receptor E like 2 2
MIRT528202 NELFE negative elongation factor complex member E 2 2
MIRT529123 HOMEZ homeobox and leucine zipper encoding 2 2
MIRT529484 TPD52L3 tumor protein D52 like 3 2 2
MIRT530760 ZNF582 zinc finger protein 582 2 2
MIRT531930 IL12RB2 interleukin 12 receptor subunit beta 2 2 2
MIRT532347 PLEK pleckstrin 2 2
MIRT532819 ZNF827 zinc finger protein 827 2 2
MIRT533262 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT533518 TRIM13 tripartite motif containing 13 2 2
MIRT534279 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534483 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT538555 CELF1 CUGBP Elav-like family member 1 2 4
MIRT538801 C2CD5 C2 calcium dependent domain containing 5 2 2
MIRT553759 TAOK1 TAO kinase 1 2 2
MIRT556035 MXD1 MAX dimerization protein 1 2 2
MIRT557541 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT562451 CSDE1 cold shock domain containing E1 2 2
MIRT563686 RPS26 ribosomal protein S26 2 2
MIRT568249 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT568422 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT574053 PROSC pyridoxal phosphate binding protein 2 2
MIRT606825 APBB2 amyloid beta precursor protein binding family B member 2 2 2
MIRT609585 GPM6B glycoprotein M6B 2 2
MIRT609680 TMEM213 transmembrane protein 213 2 2
MIRT611223 ZNF274 zinc finger protein 274 2 2
MIRT612585 SYNGAP1 synaptic Ras GTPase activating protein 1 2 4
MIRT613585 MDGA2 MAM domain containing glycosylphosphatidylinositol anchor 2 2 2
MIRT614396 C11orf45 chromosome 11 open reading frame 45 2 2
MIRT615562 JPH2 junctophilin 2 2 2
MIRT615852 RASGRP1 RAS guanyl releasing protein 1 2 2
MIRT615934 MAP1LC3B microtubule associated protein 1 light chain 3 beta 2 2
MIRT617635 RXRA retinoid X receptor alpha 2 2
MIRT618058 PCDH19 protocadherin 19 2 2
MIRT618747 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT623739 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT629609 NOL10 nucleolar protein 10 2 2
MIRT635219 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT638035 SHPK sedoheptulokinase 2 2
MIRT638545 KIAA1549 KIAA1549 2 2
MIRT645853 AFF2 AF4/FMR2 family member 2 2 2
MIRT646023 S100A7A S100 calcium binding protein A7A 2 2
MIRT646562 ALDH5A1 aldehyde dehydrogenase 5 family member A1 2 2
MIRT646735 FADS1 fatty acid desaturase 1 2 2
MIRT652853 TACC1 transforming acidic coiled-coil containing protein 1 2 2
MIRT654754 PRKCB protein kinase C beta 2 2
MIRT655238 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT655627 ONECUT1 one cut homeobox 1 2 2
MIRT655892 NEK9 NIMA related kinase 9 2 2
MIRT656184 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT656551 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT657743 GNG12 G protein subunit gamma 12 2 2
MIRT659981 C2CD2L C2CD2 like 2 2
MIRT660824 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT663511 AGMO alkylglycerol monooxygenase 2 2
MIRT666613 REEP2 receptor accessory protein 2 2 2
MIRT668266 FOXO3 forkhead box O3 2 2
MIRT669395 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT669512 ARHGAP26 Rho GTPase activating protein 26 2 2
MIRT678895 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT685122 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT685674 PSMB7 proteasome subunit beta 7 2 2
MIRT690647 RPF2 ribosome production factor 2 homolog 2 2
MIRT697114 OTUD5 OTU deubiquitinase 5 2 2
MIRT697742 USP5 ubiquitin specific peptidase 5 2 2
MIRT698584 TEX261 testis expressed 261 2 2
MIRT700075 RNF38 ring finger protein 38 2 2
MIRT709340 ZNF35 zinc finger protein 35 2 2
MIRT711071 NLGN2 neuroligin 2 2 2
MIRT714634 TM4SF18 transmembrane 4 L six family member 18 2 2
MIRT715421 SPOPL speckle type BTB/POZ protein like 2 2
MIRT718663 HNF4A hepatocyte nuclear factor 4 alpha 2 2
MIRT718931 TRIM66 tripartite motif containing 66 2 2
MIRT720640 ELF5 E74 like ETS transcription factor 5 2 2
MIRT720788 PRKRIP1 PRKR interacting protein 1 2 2
MIRT721289 TRABD2A TraB domain containing 2A 2 2
MIRT722893 LRRC20 leucine rich repeat containing 20 2 2
MIRT724307 KCNH1 potassium voltage-gated channel subfamily H member 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-520a-5p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-520a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-miR-520a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-520a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-520a-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-520a-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-520a-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-520a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-520a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission