>HES7|NM_001165967|3'UTR
   1 GCCTTGGGGGGTGGTGGGGGCGGGGTCTAGGGGTGGGGTAGAGACTCCAGCCCGAGGGCAGCAGAGGGACCCGGGCGTCC
  81 GGGCGAGCAGGTGTTGGGGAGGGCAGTGGGGCGCGCGGGCTCAGCGCGCGGGTGAGATGTGGTCTATATTAGAGTATCTA
 161 TATAAATATATATTTCCCTGGTTCCTGTCCCTTTTCCCTGCCCCAACTTCTCCCTTGCGTCTAGGATTGTACTCTCTCTG
 241 CCCCTCAGCCCAGTCCCAGTCCCTTCCCGAGTCCCTAGTGCATGGAATAAAGTGGTTATTAAATCCCCGTGTGTCCCCGA
 321 GCCAGGGGCCTGCCTTTATCTCGACGTCCACGCCCACTTTCCCTTCCCTTCTGTCTCCCACCCTCAGTCCTGCTCTCCAT
 401 GGCCCAAGCCCCGGGGCAGACAGGTAAGTAAAGAAGAGAGCAGAGCGGGAACTGAGATCGAAATTGAAACCAGGTGGAAA
 481 GAGAGAGATAGGGTAGGGGGAGAAGGGATGGGGGCCTTTAAGAAAAAAACGGATAAAAAGGAAAAATTGAAATAAAATCG
 561 ACTCTGGTGGGATTCGAACCCACAACCTTTGAATTGCTCTATTCGTCACTAGAAGTCCAATGCGCTATCCATTGCGCCAC
 641 AGAGCCACCCGACGAACGGCGGCGTCTTGTAGCTTACGGGTACTAGAGTGGGAATGGGGCAGGGTTGGGGAGCGGGGCTA
 721 AGGGACTTGGGCGGGACATGCCAGGAGGGCGCGGTTTGGATCTCAGAGGCCAAGCCAGGTAGAGGTAGCGGGCGCAAAGC
 801 ATGTTAGCCAGGTGAGAGAGAGGGCGCACATGGGTCGAAAAAACAGGGAGGGAGAGCAACCGAAAATGGCTGAGCGAGCG
 881 AGTGCAGAGCTCCGGCTGCCCGCTTGGGGGGTGTTTCCGGCTCAGGCGCTCCCCACTCCCAGATATAGTCCCACCCAAAT
 961 AAACTAGTTTTGTTGTAAATTAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agggcccuuGAGUAGUCAGAGg 5' | | || ||||| Target 5' ctttcccttCCCTTCTGTCTCc 3'	357 - 378	117.00	-14.80
2	miRNA 3' agggcccuuGAGU--AGUCAGAGg 5' |||| ||||| | Target 5' tctctgcccCTCAGCCCAGTCCCa 3'	235 - 258	115.00	-17.30
3	miRNA 3' agggcCCUUGAGUAGUCAGAGg 5' ||::| |: |:| ||| Target 5' gcagtGGGGCGCG-CGGGCTCa 3'	103 - 123	104.00	-14.10

Mutant ID	Mutant Position	Mutant Source
593629	12	ClinVar
COSN23450345	81	COSMIC
COSN22091299	112	COSMIC
COSN30169457	273	COSMIC
COSN26639755	355	COSMIC
COSN5421248	513	COSMIC
COSN24001295	575	COSMIC
COSN30164586	650	COSMIC
COSN28828189	671	COSMIC
COSN6661795	685	COSMIC
COSN6661794	768	COSMIC
COSN31489931	880	COSMIC
rs4792250	671	GWAS

Mutant ID	Mutant Position	Mutant Source
rs978268609	8	dbSNP
rs966418854	10	dbSNP
rs8076664	11	dbSNP
rs1450989137	12	dbSNP
rs535914789	12	dbSNP
rs1323346482	15	dbSNP
rs1336479273	18	dbSNP
rs922223596	20	dbSNP
rs1454945978	21	dbSNP
rs1416379519	22	dbSNP
rs1285468966	25	dbSNP
rs1010525340	30	dbSNP
rs1213440429	31	dbSNP
rs565453136	35	dbSNP
rs1319901373	39	dbSNP
rs1201611001	41	dbSNP
rs1242236481	44	dbSNP
rs966299468	46	dbSNP
rs1020899015	47	dbSNP
rs1475149482	49	dbSNP
rs1426493506	51	dbSNP
rs988929677	53	dbSNP
rs957489418	54	dbSNP
rs1403293523	55	dbSNP
rs1033980399	60	dbSNP
rs1003392417	62	dbSNP
rs1414710976	64	dbSNP
rs1465372690	67	dbSNP
rs1377935202	70	dbSNP
rs1398917247	72	dbSNP
rs1278276737	73	dbSNP
rs8076629	81	dbSNP
rs1262304441	82	dbSNP
rs1001497070	86	dbSNP
rs1201932652	88	dbSNP
rs1047540918	93	dbSNP
rs1282491713	96	dbSNP
rs1446631716	97	dbSNP
rs1194480887	98	dbSNP
rs1265352553	103	dbSNP
rs905830986	106	dbSNP
rs1199272703	109	dbSNP
rs751740177	114	dbSNP
rs766566795	115	dbSNP
rs559461603	116	dbSNP
rs1024243984	118	dbSNP
rs1253291240	119	dbSNP
rs1014616261	125	dbSNP
rs1298294127	125	dbSNP
rs897238266	126	dbSNP
rs1300557531	127	dbSNP
rs1483147486	130	dbSNP
rs114049508	131	dbSNP
rs1353276565	133	dbSNP
rs571199056	133	dbSNP
rs552824640	134	dbSNP
rs531263972	135	dbSNP
rs541012018	146	dbSNP
rs1236831665	151	dbSNP
rs1005351109	157	dbSNP
rs1221810635	161	dbSNP
rs1268740035	162	dbSNP
rs1351766883	167	dbSNP
rs1308709073	168	dbSNP
rs941306526	172	dbSNP
rs888207014	198	dbSNP
rs1239870042	201	dbSNP
rs1337555400	202	dbSNP
rs1049478935	212	dbSNP
rs1332143926	232	dbSNP
rs1363527721	241	dbSNP
rs1438720871	247	dbSNP
rs1395340699	255	dbSNP
rs1158837096	259	dbSNP
rs1381747519	267	dbSNP
rs1402690383	285	dbSNP
rs773751563	294	dbSNP
rs1422267423	295	dbSNP
rs1292429038	308	dbSNP
rs1391368100	311	dbSNP
rs932326227	322	dbSNP
rs1417538373	324	dbSNP
rs1375820589	331	dbSNP
rs890054537	337	dbSNP
rs1357530571	338	dbSNP
rs1244245003	340	dbSNP
rs1266044145	341	dbSNP
rs1489763846	347	dbSNP
rs1158803920	353	dbSNP
rs1050405047	360	dbSNP
rs922286872	361	dbSNP
rs934241343	363	dbSNP
rs1366149912	368	dbSNP
rs1458525590	369	dbSNP
rs1180875866	370	dbSNP
rs753603130	371	dbSNP
rs1442323129	381	dbSNP
rs1040699425	382	dbSNP
rs944985152	385	dbSNP
rs922789278	388	dbSNP
rs1459407097	399	dbSNP
rs765727546	409	dbSNP
rs1423721023	428	dbSNP
rs1447313611	433	dbSNP
rs1258727496	435	dbSNP
rs1380867443	436	dbSNP
rs1395615680	438	dbSNP
rs1313562806	441	dbSNP
rs1323541057	446	dbSNP
rs945168238	450	dbSNP
rs74967814	454	dbSNP
rs1487476347	458	dbSNP
rs988939646	460	dbSNP
rs1200920322	467	dbSNP
rs1241621312	469	dbSNP
rs989114624	470	dbSNP
rs959003914	471	dbSNP
rs1256381859	473	dbSNP
rs1425087170	481	dbSNP
rs1285598523	488	dbSNP
rs1190375714	489	dbSNP
rs1422908756	489	dbSNP
rs1033621474	490	dbSNP
rs982463295	492	dbSNP
rs192195537	493	dbSNP
rs1026602642	495	dbSNP
rs993330831	498	dbSNP
rs1352971282	500	dbSNP
rs530180639	506	dbSNP
rs559802816	513	dbSNP
rs980132590	514	dbSNP
rs970148595	516	dbSNP
rs188007795	523	dbSNP
rs1017000434	528	dbSNP
rs1220948261	530	dbSNP
rs1341694023	530	dbSNP
rs1243772670	531	dbSNP
rs771638699	533	dbSNP
rs1024760750	537	dbSNP
rs1359595532	546	dbSNP
rs1213826163	547	dbSNP
rs1256282399	547	dbSNP
rs1484024624	547	dbSNP
rs1005572983	552	dbSNP
rs889806251	553	dbSNP
rs1478121507	554	dbSNP
rs182882481	556	dbSNP
rs573726684	557	dbSNP
rs1361187643	558	dbSNP
rs934270019	558	dbSNP
rs1451822705	559	dbSNP
rs901422147	559	dbSNP
rs565171042	560	dbSNP
rs766102687	561	dbSNP
rs945513767	562	dbSNP
rs1313607123	563	dbSNP
rs915006168	564	dbSNP
rs989167081	565	dbSNP
rs1218140757	566	dbSNP
rs543291130	566	dbSNP
rs555500961	567	dbSNP
rs926311542	568	dbSNP
rs981794113	569	dbSNP
rs763077546	570	dbSNP
rs971093753	571	dbSNP
rs1209309115	572	dbSNP
rs1301363980	572	dbSNP
rs926147669	573	dbSNP
rs1437733266	575	dbSNP
rs191934127	575	dbSNP
rs554308736	576	dbSNP
rs1308143617	577	dbSNP
rs970587615	578	dbSNP
rs1287048145	579	dbSNP
rs763560877	580	dbSNP
rs1248352722	581	dbSNP
rs971901808	583	dbSNP
rs1456311978	584	dbSNP
rs963182275	585	dbSNP
rs749082436	586	dbSNP
rs1161544494	587	dbSNP
rs1005666618	588	dbSNP
rs1167579741	588	dbSNP
rs1413108319	588	dbSNP
rs889868394	589	dbSNP
rs1028781092	590	dbSNP
rs774099063	591	dbSNP
rs998158254	591	dbSNP
rs1448460030	592	dbSNP
rs187488820	592	dbSNP
rs1355085769	594	dbSNP
rs1315980168	596	dbSNP
rs536050561	596	dbSNP
rs1009710856	597	dbSNP
rs1441025765	598	dbSNP
rs571997712	599	dbSNP
rs1053870003	600	dbSNP
rs1183659653	600	dbSNP
rs1167780605	601	dbSNP
rs996686932	601	dbSNP
rs182885508	602	dbSNP
rs531620664	602	dbSNP
rs1339495734	603	dbSNP
rs150811754	604	dbSNP
rs772471054	604	dbSNP
rs1046492807	605	dbSNP
rs1423411051	606	dbSNP
rs949050119	607	dbSNP
rs919192040	608	dbSNP
rs1245206322	609	dbSNP
rs904781013	609	dbSNP
rs1195082561	610	dbSNP
rs1198354679	612	dbSNP
rs1477277749	612	dbSNP
rs781112763	614	dbSNP
rs971996695	615	dbSNP
rs755082518	616	dbSNP
rs1044961511	617	dbSNP
rs1278822667	617	dbSNP
rs948882075	618	dbSNP
rs751638498	619	dbSNP
rs917335917	620	dbSNP
rs963276078	621	dbSNP
rs766591866	622	dbSNP
rs985978669	623	dbSNP
rs954273353	624	dbSNP
rs1028374318	625	dbSNP
rs1441137715	626	dbSNP
rs998607506	627	dbSNP
rs1198609774	628	dbSNP
rs965384774	628	dbSNP
rs1020894950	629	dbSNP
rs952644452	630	dbSNP
rs1009804038	631	dbSNP
rs571205404	632	dbSNP
rs1053920841	633	dbSNP
rs1002339250	634	dbSNP
rs1384949105	635	dbSNP
rs556220964	636	dbSNP
rs1442797867	637	dbSNP
rs975658880	638	dbSNP
rs1046122125	640	dbSNP
rs949136411	641	dbSNP
rs1423440701	642	dbSNP
rs918953395	644	dbSNP
rs537707573	645	dbSNP
rs758509334	646	dbSNP
rs909088958	647	dbSNP
rs190639917	648	dbSNP
rs953210896	649	dbSNP
rs921367534	650	dbSNP
rs530315960	651	dbSNP
rs1442850	652	dbSNP
rs187062164	653	dbSNP
rs141418362	654	dbSNP
rs1266607853	655	dbSNP
rs958287101	656	dbSNP
rs565256703	657	dbSNP
rs184104843	658	dbSNP
rs905382301	659	dbSNP
rs531460779	660	dbSNP
rs1013369865	661	dbSNP
rs897574377	662	dbSNP
rs777271243	664	dbSNP
rs540088263	666	dbSNP
rs1357826300	669	dbSNP
rs1357935871	669	dbSNP
rs1277999250	670	dbSNP
rs4792250	671	dbSNP
rs887707123	672	dbSNP
rs1199401143	674	dbSNP
rs1377506320	675	dbSNP
rs1476162549	677	dbSNP
rs773776763	678	dbSNP
rs572192881	679	dbSNP
rs1478060335	680	dbSNP
rs75711247	685	dbSNP
rs1178922409	687	dbSNP
rs1032018354	688	dbSNP
rs1465685044	690	dbSNP
rs1303521753	692	dbSNP
rs1377314472	694	dbSNP
rs1256610708	699	dbSNP
rs1298174344	700	dbSNP
rs534725291	700	dbSNP
rs1216693720	701	dbSNP
rs1211324792	703	dbSNP
rs1299570872	710	dbSNP
rs1310097280	713	dbSNP
rs1486489362	714	dbSNP
rs1486392899	715	dbSNP
rs1213805814	716	dbSNP
rs1283450968	717	dbSNP
rs1486117290	722	dbSNP
rs923159498	727	dbSNP
rs867013752	729	dbSNP
rs1422745419	732	dbSNP
rs1000501849	733	dbSNP
rs112675209	735	dbSNP
rs1317021353	740	dbSNP
rs1361748167	741	dbSNP
rs944167774	744	dbSNP
rs913950714	753	dbSNP
rs1308478749	761	dbSNP
rs1442849	768	dbSNP
rs1377619740	772	dbSNP
rs958005912	776	dbSNP
rs1367389539	784	dbSNP
rs547749612	793	dbSNP
rs1032736515	808	dbSNP
rs73243503	812	dbSNP
rs1303763499	820	dbSNP
rs1349596474	823	dbSNP
rs769512869	824	dbSNP
rs1025144811	825	dbSNP
rs1284618119	836	dbSNP
rs1317474519	847	dbSNP
rs1217810971	853	dbSNP
rs1296622163	856	dbSNP
rs7219529	859	dbSNP
rs1244880149	862	dbSNP
rs1013760371	873	dbSNP
rs748004949	876	dbSNP
rs1255128283	878	dbSNP
rs1437999667	879	dbSNP
rs537845272	888	dbSNP
rs781083843	896	dbSNP
rs1005914515	902	dbSNP
rs1048478841	903	dbSNP
rs1417080480	906	dbSNP
rs887469446	907	dbSNP
rs931319895	908	dbSNP
rs867978682	909	dbSNP
rs567320658	910	dbSNP
rs921297446	911	dbSNP
rs1040096804	912	dbSNP
rs1476077534	912	dbSNP
rs1224946714	915	dbSNP
rs1287714375	917	dbSNP
rs1321046287	931	dbSNP
rs1050485046	932	dbSNP
rs931924316	933	dbSNP
rs901717045	946	dbSNP
rs1040244264	950	dbSNP
rs945873506	954	dbSNP
rs914014451	956	dbSNP
rs988206158	973	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2013

BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.