miRTarBase - #MIRT483055


—
pre-miRNA Information
pre-miRNA hsa-mir-4446   
Genomic Coordinates chr3: 113594876 - 113594942
Description Homo sapiens miR-4446 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4446-5p
Sequence 8| AUUUCCCUGCCAUUCCCUUGGC |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1356015605 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FOXB1   
Synonyms FKH5, HFKH-5
Description forkhead box B1
Transcript NM_012182   
Expression
Putative miRNA Targets on FOXB1
3'UTR of FOXB1
(miRNA target sites are highlighted)		 
>FOXB1|NM_012182|3'UTR
   1 CC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20982976 50 COSMIC
COSN1178499 150 COSMIC
COSN6277139 212 COSMIC
COSN26844892 537 COSMIC
COSN29617360 556 COSMIC
COSN25747798 919 COSMIC
COSN25093447 947 COSMIC
COSN27316390 974 COSMIC
COSN27243676 1305 COSMIC
COSN8748366 1399 COSMIC
COSN5174261 1430 COSMIC
COSN8748367 1438 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1372610606 1 dbSNP
rs1393019827 1 dbSNP
rs1168894941 3 dbSNP
rs760413711 5 dbSNP
rs1158841800 9 dbSNP
rs765627268 12 dbSNP
rs991735501 19 dbSNP
rs750808428 21 dbSNP
rs376335632 22 dbSNP
rs1370292167 24 dbSNP
rs72739945 26 dbSNP
rs1359471653 29 dbSNP
rs981253679 31 dbSNP
rs781156396 32 dbSNP
rs1301096314 33 dbSNP
rs748313472 34 dbSNP
rs756335501 36 dbSNP
rs1286947957 37 dbSNP
rs918910291 38 dbSNP
rs188651499 40 dbSNP
rs777629396 42 dbSNP
rs749073690 45 dbSNP
rs770685026 46 dbSNP
rs774317103 47 dbSNP
rs1404044268 50 dbSNP
rs745826978 51 dbSNP
rs1293597202 62 dbSNP
rs8040887 82 dbSNP
rs1405807848 97 dbSNP
rs1032656422 101 dbSNP
rs748743103 106 dbSNP
rs1374212775 109 dbSNP
rs34554672 115 dbSNP
rs1176357780 128 dbSNP
rs1290735008 129 dbSNP
rs1479636170 130 dbSNP
rs1431925412 135 dbSNP
rs1039602241 137 dbSNP
rs1451860215 138 dbSNP
rs144651992 141 dbSNP
rs1193630800 144 dbSNP
rs997992489 157 dbSNP
rs1251749501 159 dbSNP
rs1321088442 164 dbSNP
rs1212815963 165 dbSNP
rs965115090 171 dbSNP
rs972426042 179 dbSNP
rs1326922605 185 dbSNP
rs919460334 186 dbSNP
rs573608083 188 dbSNP
rs985098951 189 dbSNP
rs1408714556 190 dbSNP
rs1177685260 192 dbSNP
rs1362800152 200 dbSNP
rs902488020 202 dbSNP
rs35574107 203 dbSNP
rs1257740155 207 dbSNP
rs541043502 208 dbSNP
rs1000888710 215 dbSNP
rs1202934850 216 dbSNP
rs559440152 221 dbSNP
rs1055131811 231 dbSNP
rs1264769195 238 dbSNP
rs1204128382 241 dbSNP
rs1383026054 243 dbSNP
rs896465411 245 dbSNP
rs1032891086 247 dbSNP
rs113312088 249 dbSNP
rs17237138 250 dbSNP
rs1336399082 252 dbSNP
rs1314506575 260 dbSNP
rs577197772 267 dbSNP
rs367684191 269 dbSNP
rs1453760124 272 dbSNP
rs544949511 281 dbSNP
rs774020954 290 dbSNP
rs1032297453 294 dbSNP
rs1453504712 295 dbSNP
rs1455068508 300 dbSNP
rs1380346608 301 dbSNP
rs1050348571 306 dbSNP
rs1314584917 309 dbSNP
rs1380857561 312 dbSNP
rs1023217563 313 dbSNP
rs971284167 315 dbSNP
rs1188175116 316 dbSNP
rs981569012 317 dbSNP
rs919024551 320 dbSNP
rs887722475 322 dbSNP
rs1006735729 326 dbSNP
rs761803708 327 dbSNP
rs1243792699 335 dbSNP
rs1361685665 348 dbSNP
rs1316297089 350 dbSNP
rs1430671811 355 dbSNP
rs972478504 357 dbSNP
rs563235216 361 dbSNP
rs1025812382 371 dbSNP
rs772178122 372 dbSNP
rs908915293 378 dbSNP
rs943613624 398 dbSNP
rs1202489711 401 dbSNP
rs547857601 404 dbSNP
rs1039309250 406 dbSNP
rs923423001 407 dbSNP
rs933519890 410 dbSNP
rs772862904 414 dbSNP
rs902604839 417 dbSNP
rs1488501523 419 dbSNP
rs193289821 421 dbSNP
rs1409230204 423 dbSNP
rs1290742032 427 dbSNP
rs548224433 427 dbSNP
rs144012029 428 dbSNP
rs199935228 429 dbSNP
rs917953155 430 dbSNP
rs949347970 433 dbSNP
rs1302104472 434 dbSNP
rs569336370 435 dbSNP
rs8024930 436 dbSNP
rs936737717 437 dbSNP
rs8024933 438 dbSNP
rs1470304710 439 dbSNP
rs760578681 442 dbSNP
rs1404161782 443 dbSNP
rs889585705 446 dbSNP
rs1478002855 448 dbSNP
rs1006789411 449 dbSNP
rs1197510332 451 dbSNP
rs528540142 456 dbSNP
rs1040919948 458 dbSNP
rs994236984 459 dbSNP
rs1436169009 461 dbSNP
rs1025270554 462 dbSNP
rs952577804 467 dbSNP
rs1013232026 468 dbSNP
rs1372411528 469 dbSNP
rs1022893965 485 dbSNP
rs907006902 488 dbSNP
rs1002710625 489 dbSNP
rs148088613 490 dbSNP
rs1025984779 491 dbSNP
rs950461221 495 dbSNP
rs1440742651 497 dbSNP
rs1352291947 502 dbSNP
rs1330752813 503 dbSNP
rs1222363098 506 dbSNP
rs1466120423 508 dbSNP
rs1405043436 513 dbSNP
rs1016459103 523 dbSNP
rs984543613 527 dbSNP
rs1426066753 529 dbSNP
rs1176843574 531 dbSNP
rs991097540 536 dbSNP
rs1015861660 540 dbSNP
rs1199800377 541 dbSNP
rs141980588 542 dbSNP
rs532545886 545 dbSNP
rs1261641101 547 dbSNP
rs1205904519 548 dbSNP
rs1313153706 552 dbSNP
rs1278840586 554 dbSNP
rs1222873563 555 dbSNP
rs918164437 558 dbSNP
rs1310867596 559 dbSNP
rs530679260 563 dbSNP
rs1382019440 564 dbSNP
rs1334627731 568 dbSNP
rs975374474 569 dbSNP
rs1158599818 577 dbSNP
rs1399230846 581 dbSNP
rs551334890 583 dbSNP
rs933447462 584 dbSNP
rs117102356 587 dbSNP
rs924141901 592 dbSNP
rs1480490243 593 dbSNP
rs1180480968 595 dbSNP
rs1432004782 596 dbSNP
rs1483754627 598 dbSNP
rs1241946053 608 dbSNP
rs1214593285 609 dbSNP
rs1314833322 612 dbSNP
rs936737131 614 dbSNP
rs536855642 618 dbSNP
rs1053859679 621 dbSNP
rs1240171585 625 dbSNP
rs1481081189 628 dbSNP
rs1175791262 630 dbSNP
rs1427333799 638 dbSNP
rs867741564 642 dbSNP
rs1288116330 645 dbSNP
rs1428869665 647 dbSNP
rs911085133 650 dbSNP
rs1159476423 651 dbSNP
rs1329731446 651 dbSNP
rs763101876 653 dbSNP
rs942531345 664 dbSNP
rs1439679248 665 dbSNP
rs764107966 666 dbSNP
rs948097308 671 dbSNP
rs530709750 675 dbSNP
rs1261463078 677 dbSNP
rs552014813 680 dbSNP
rs901100760 681 dbSNP
rs1264801966 683 dbSNP
rs548466238 684 dbSNP
rs1216928859 688 dbSNP
rs994065237 690 dbSNP
rs1044664718 691 dbSNP
rs1340800637 694 dbSNP
rs907125230 699 dbSNP
rs1294783796 704 dbSNP
rs1212517359 705 dbSNP
rs1342174952 706 dbSNP
rs888096407 713 dbSNP
rs1003234638 715 dbSNP
rs1214682524 718 dbSNP
rs550759633 724 dbSNP
rs1295423038 728 dbSNP
rs1034086337 742 dbSNP
rs796359465 743 dbSNP
rs567039624 744 dbSNP
rs886294884 747 dbSNP
rs534440860 758 dbSNP
rs1168968307 766 dbSNP
rs1478977818 772 dbSNP
rs1005911803 777 dbSNP
rs1193890289 786 dbSNP
rs1203433244 786 dbSNP
rs1479932474 792 dbSNP
rs1266129013 796 dbSNP
rs552648888 799 dbSNP
rs1271584567 800 dbSNP
rs1202395369 803 dbSNP
rs1012416957 809 dbSNP
rs1278661595 811 dbSNP
rs577260397 815 dbSNP
rs751672584 825 dbSNP
rs1296912841 827 dbSNP
rs538208273 827 dbSNP
rs1030967985 828 dbSNP
rs954976694 831 dbSNP
rs749239683 836 dbSNP
rs1467678069 839 dbSNP
rs1401449047 841 dbSNP
rs1176228361 842 dbSNP
rs1168570311 844 dbSNP
rs1375516025 845 dbSNP
rs978380323 849 dbSNP
rs1433226123 853 dbSNP
rs1249258489 867 dbSNP
rs1031446370 876 dbSNP
rs958053164 878 dbSNP
rs924088044 880 dbSNP
rs1366015028 886 dbSNP
rs1202724354 890 dbSNP
rs1321169145 916 dbSNP
rs990007061 922 dbSNP
rs570263701 931 dbSNP
rs1489303431 932 dbSNP
rs989540678 933 dbSNP
rs1335212730 935 dbSNP
rs150698391 936 dbSNP
rs1430754190 940 dbSNP
rs1269134616 942 dbSNP
rs1336671352 946 dbSNP
rs1468523892 951 dbSNP
rs533296774 952 dbSNP
rs1173939632 966 dbSNP
rs542826123 968 dbSNP
rs1156376219 970 dbSNP
rs200612505 971 dbSNP
rs1238652335 972 dbSNP
rs1162815891 974 dbSNP
rs1175284960 974 dbSNP
rs1188074226 974 dbSNP
rs1380409534 974 dbSNP
rs1383711961 974 dbSNP
rs1420933326 974 dbSNP
rs1446215151 974 dbSNP
rs1471796505 974 dbSNP
rs1491039985 974 dbSNP
rs149620499 974 dbSNP
rs541012496 974 dbSNP
rs71429555 974 dbSNP
rs74017965 975 dbSNP
rs1294371183 976 dbSNP
rs922410982 977 dbSNP
rs1360553894 978 dbSNP
rs1222254176 979 dbSNP
rs74681684 980 dbSNP
rs76221085 981 dbSNP
rs1285308532 982 dbSNP
rs1288268591 982 dbSNP
rs1449291135 983 dbSNP
rs1193987465 988 dbSNP
rs916672273 990 dbSNP
rs1241639175 991 dbSNP
rs77262352 991 dbSNP
rs202088664 993 dbSNP
rs1185604347 995 dbSNP
rs1302046995 995 dbSNP
rs1386129715 996 dbSNP
rs1403527555 997 dbSNP
rs897541088 1001 dbSNP
rs1392705250 1005 dbSNP
rs1163798963 1006 dbSNP
rs1002586828 1011 dbSNP
rs1474939413 1014 dbSNP
rs1423693229 1024 dbSNP
rs1161261519 1029 dbSNP
rs948014193 1037 dbSNP
rs184240701 1044 dbSNP
rs1401277792 1047 dbSNP
rs1478305673 1053 dbSNP
rs1316977805 1057 dbSNP
rs888137943 1058 dbSNP
rs1219380850 1059 dbSNP
rs1385863306 1067 dbSNP
rs941027720 1073 dbSNP
rs1195764358 1075 dbSNP
rs1316412891 1089 dbSNP
rs1055590696 1090 dbSNP
rs894230043 1091 dbSNP
rs1013977661 1095 dbSNP
rs781701980 1105 dbSNP
rs1332353857 1110 dbSNP
rs1324095854 1114 dbSNP
rs1409355963 1116 dbSNP
rs560956529 1118 dbSNP
rs1397835876 1119 dbSNP
rs1025158614 1125 dbSNP
rs1465952183 1141 dbSNP
rs1428788452 1155 dbSNP
rs906685988 1162 dbSNP
rs750742289 1164 dbSNP
rs1031246228 1165 dbSNP
rs1181693234 1166 dbSNP
rs1456866610 1175 dbSNP
rs958320436 1176 dbSNP
rs1199586963 1180 dbSNP
rs1047663801 1185 dbSNP
rs1217162255 1189 dbSNP
rs1369076082 1196 dbSNP
rs756569761 1199 dbSNP
rs886242434 1202 dbSNP
rs1445951683 1212 dbSNP
rs1018197078 1221 dbSNP
rs1447186449 1222 dbSNP
rs964110040 1224 dbSNP
rs1174179760 1241 dbSNP
rs1416427007 1243 dbSNP
rs1425941860 1248 dbSNP
rs976781663 1260 dbSNP
rs922451928 1267 dbSNP
rs867092186 1274 dbSNP
rs929812910 1277 dbSNP
rs983138635 1284 dbSNP
rs1463571272 1286 dbSNP
rs1179834460 1292 dbSNP
rs1207573272 1292 dbSNP
rs1313659607 1292 dbSNP
rs35034082 1292 dbSNP
rs550015457 1292 dbSNP
rs909797871 1299 dbSNP
rs1037818388 1301 dbSNP
rs1243919252 1304 dbSNP
rs397697112 1305 dbSNP
rs1055474570 1306 dbSNP
rs1444305638 1308 dbSNP
rs900259436 1317 dbSNP
rs894115491 1324 dbSNP
rs1450456893 1327 dbSNP
rs546678604 1329 dbSNP
rs996363732 1345 dbSNP
rs1317919705 1351 dbSNP
rs1470457710 1354 dbSNP
rs780287697 1358 dbSNP
rs1382295048 1369 dbSNP
rs1029996961 1370 dbSNP
rs373924704 1372 dbSNP
rs954550723 1380 dbSNP
rs1444626709 1381 dbSNP
rs999766579 1385 dbSNP
rs1031276604 1386 dbSNP
rs906730636 1388 dbSNP
rs1470631484 1393 dbSNP
rs999699005 1403 dbSNP
rs77058074 1410 dbSNP
rs894067011 1418 dbSNP
rs1011086332 1419 dbSNP
rs1404896043 1424 dbSNP
rs540775325 1425 dbSNP
rs1332586883 1427 dbSNP
rs1337855313 1428 dbSNP
rs1018249293 1429 dbSNP
rs963995091 1429 dbSNP
rs76727568 1430 dbSNP
rs1029738459 1431 dbSNP
rs1362529672 1435 dbSNP
rs916767487 1440 dbSNP
rs1298954404 1441 dbSNP
rs1457476793 1445 dbSNP
rs1348592215 1447 dbSNP
rs951328373 1455 dbSNP
rs1279419137 1465 dbSNP
rs1419302736 1471 dbSNP
rs1192452855 1472 dbSNP
rs779669383 1476 dbSNP
rs969494653 1481 dbSNP
rs982626938 1488 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgguucccuuaccguCCCUUUa 5'
                         |||||| 
Target 5' -------------uuGGGAAAa 3'
 		1 - 9
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 27023.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084074. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + A
Location of target site ENST00000396057.4 | 3UTR | UUGGGAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset Chi_ControlA_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control A
Location of target site ENST00000396057.4 | 3UTR | UUGGGAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084043
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep2
Location of target site ENST00000396057.4 | 3UTR | UGUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000396057.4 | 3UTR | UGUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000396057.4 | 3UTR | UGUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000396057.4 | 3UTR | UGUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000396057.4 | 3UTR | GUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000396057.4 | 3UTR | UGUUGGGAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084074
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SantaCruzAb
Location of target site ENST00000396057.4 | 3UTR | GUUGGGAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000396057.4 | 3UTR | UGUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000396057.4 | 3UTR | UGUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000396057.4 | 3UTR | GUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000396057.4 | 3UTR | GUUGGGAAAAAAAAAAAAAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000396057.4 | 3UTR | UUUAUUUUAUUGUUGGGAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000396057.4 | 3UTR | UUGUUGGGAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
223 hsa-miR-4446-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT078060 PCTP phosphatidylcholine transfer protein 2 2
MIRT099072 FOXC1 forkhead box C1 2 2
MIRT130186 TXNIP thioredoxin interacting protein 2 2
MIRT148786 NARS asparaginyl-tRNA synthetase 2 2
MIRT261965 SEPHS1 selenophosphate synthetase 1 2 2
MIRT345867 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT409087 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT451883 SOD2 superoxide dismutase 2 2 4
MIRT469236 RHOB ras homolog family member B 2 2
MIRT469435 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT483055 FOXB1 forkhead box B1 2 8
MIRT484640 TBC1D5 TBC1 domain family member 5 2 6
MIRT493106 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 6
MIRT497307 TMEFF2 transmembrane protein with EGF like and two follistatin like domains 2 2 2
MIRT497798 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT501273 SCARB2 scavenger receptor class B member 2 2 4
MIRT506756 KMT2D lysine methyltransferase 2D 2 2
MIRT511986 EEF2 eukaryotic translation elongation factor 2 2 4
MIRT513126 ZNF431 zinc finger protein 431 2 2
MIRT519733 ZNF394 zinc finger protein 394 2 4
MIRT520351 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT520542 TPPP tubulin polymerization promoting protein 2 8
MIRT530782 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 2
MIRT531112 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT532144 GALNT8 polypeptide N-acetylgalactosaminyltransferase 8 2 2
MIRT533208 WAPAL WAPL cohesin release factor 2 2
MIRT533419 TWF1 twinfilin actin binding protein 1 2 2
MIRT534063 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT534288 SLAIN2 SLAIN motif family member 2 2 2
MIRT537796 EFNB2 ephrin B2 2 2
MIRT538017 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT538058 DMD dystrophin 2 2
MIRT538132 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT538680 CCDC80 coiled-coil domain containing 80 2 2
MIRT538788 C3orf52 chromosome 3 open reading frame 52 2 2
MIRT542762 PPAP2B phospholipid phosphatase 3 2 2
MIRT546861 RAB10 RAB10, member RAS oncogene family 2 4
MIRT547418 MED4 mediator complex subunit 4 2 4
MIRT551633 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT552329 ZNF704 zinc finger protein 704 2 2
MIRT556124 MFSD9 major facilitator superfamily domain containing 9 2 4
MIRT559290 ATXN1 ataxin 1 2 2
MIRT562125 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT563777 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 2 2
MIRT564430 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT566102 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT567126 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT571213 RRS1 ribosome biogenesis regulator homolog 2 2
MIRT571939 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT571967 KIF21A kinesin family member 21A 2 2
MIRT606792 IL1RAPL1 interleukin 1 receptor accessory protein like 1 2 8
MIRT607351 TNS1 tensin 1 2 4
MIRT609416 GJB7 gap junction protein beta 7 2 4
MIRT609522 AZI2 5-azacytidine induced 2 2 4
MIRT611218 FAM174B family with sequence similarity 174 member B 2 2
MIRT611385 TRIP10 thyroid hormone receptor interactor 10 2 2
MIRT612053 KLB klotho beta 2 4
MIRT612102 CHRM3 cholinergic receptor muscarinic 3 2 2
MIRT612146 SIX1 SIX homeobox 1 2 4
MIRT612488 SIX3 SIX homeobox 3 2 4
MIRT613685 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613763 TTC38 tetratricopeptide repeat domain 38 2 2
MIRT613876 FGD1 FYVE, RhoGEF and PH domain containing 1 2 2
MIRT613965 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 4
MIRT614894 PAPOLG poly(A) polymerase gamma 2 2
MIRT614912 NFIA nuclear factor I A 2 2
MIRT615013 ERGIC2 ERGIC and golgi 2 2 2
MIRT615106 BCL7A BCL tumor suppressor 7A 2 2
MIRT615242 FAM227A family with sequence similarity 227 member A 2 4
MIRT615695 NEGR1 neuronal growth regulator 1 2 2
MIRT615956 ERBB3 erb-b2 receptor tyrosine kinase 3 2 4
MIRT615979 FSTL4 follistatin like 4 2 2
MIRT616053 PTPRE protein tyrosine phosphatase, receptor type E 2 4
MIRT616073 TBX2 T-box 2 2 4
MIRT616234 NPAS3 neuronal PAS domain protein 3 2 2
MIRT616306 CELF2 CUGBP Elav-like family member 2 2 2
MIRT616474 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT616662 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT616887 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT616902 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT617025 SYT6 synaptotagmin 6 2 2
MIRT617162 SLC16A5 solute carrier family 16 member 5 2 2
MIRT617318 DPF3 double PHD fingers 3 2 2
MIRT617792 CHRM2 cholinergic receptor muscarinic 2 2 2
MIRT618418 DNAJC30 DnaJ heat shock protein family (Hsp40) member C30 2 2
MIRT618663 RPP40 ribonuclease P/MRP subunit p40 2 2
MIRT620212 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT620413 TFDP3 transcription factor Dp family member 3 2 2
MIRT620667 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620709 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT620956 SFT2D2 SFT2 domain containing 2 2 2
MIRT621225 LMAN1 lectin, mannose binding 1 2 2
MIRT621333 SLC11A1 solute carrier family 11 member 1 2 2
MIRT621696 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT623484 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623777 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT624215 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT624675 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT627369 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT628252 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT630790 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT635631 PRR15L proline rich 15 like 2 2
MIRT636425 MARCH1 membrane associated ring-CH-type finger 1 2 2
MIRT637295 ACTN2 actinin alpha 2 2 2
MIRT637345 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT637842 SLC2A9 solute carrier family 2 member 9 2 2
MIRT638327 RCAN1 regulator of calcineurin 1 2 2
MIRT638375 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638751 EPHA4 EPH receptor A4 2 2
MIRT638965 ARHGAP6 Rho GTPase activating protein 6 2 2
MIRT639094 GLIPR1L2 GLI pathogenesis related 1 like 2 2 2
MIRT639172 CEP70 centrosomal protein 70 2 2
MIRT639254 SLC38A1 solute carrier family 38 member 1 2 4
MIRT639368 ZCCHC24 zinc finger CCHC-type containing 24 2 4
MIRT639504 CACNA1G calcium voltage-gated channel subunit alpha1 G 2 2
MIRT639644 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 2 2
MIRT640486 EXOC5 exocyst complex component 5 2 2
MIRT641424 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT641550 LIPG lipase G, endothelial type 2 2
MIRT642180 TOR1AIP1 torsin 1A interacting protein 1 2 2
MIRT642656 RGS6 regulator of G protein signaling 6 2 2
MIRT642873 SAMD1 sterile alpha motif domain containing 1 2 2
MIRT643355 TRIM10 tripartite motif containing 10 2 2
MIRT643531 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT643998 PPP1R3G protein phosphatase 1 regulatory subunit 3G 2 2
MIRT644105 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 2 2
MIRT644421 VDR vitamin D receptor 2 2
MIRT644481 SLFN12 schlafen family member 12 2 2
MIRT644573 SPOP speckle type BTB/POZ protein 2 2
MIRT645354 SPNS1 sphingolipid transporter 1 (putative) 2 2
MIRT645383 FBLIM1 filamin binding LIM protein 1 2 2
MIRT645758 SURF6 surfeit 6 2 2
MIRT646060 VANGL2 VANGL planar cell polarity protein 2 2 2
MIRT646194 DUSP10 dual specificity phosphatase 10 2 2
MIRT647915 RGS5 regulator of G protein signaling 5 2 2
MIRT649216 AMMECR1L AMMECR1 like 2 2
MIRT649265 C17orf64 chromosome 17 open reading frame 64 2 2
MIRT649522 GTF3C3 general transcription factor IIIC subunit 3 2 2
MIRT649605 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650392 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT650835 SEMA4G semaphorin 4G 2 2
MIRT651273 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT651674 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT651763 VASP vasodilator stimulated phosphoprotein 2 2
MIRT652250 TPD52L3 tumor protein D52 like 3 2 2
MIRT652277 TOM1L2 target of myb1 like 2 membrane trafficking protein 2 2
MIRT652316 TNFSF15 TNF superfamily member 15 2 2
MIRT652342 TMOD3 tropomodulin 3 2 2
MIRT652373 TMEM57 transmembrane protein 57 2 2
MIRT652438 TMEM236 transmembrane protein 236 2 2
MIRT652723 TGFB2 transforming growth factor beta 2 2 2
MIRT652752 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT653310 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT653327 SMIM18 small integral membrane protein 18 2 2
MIRT653406 SLC7A2 solute carrier family 7 member 2 2 2
MIRT653512 SLC41A1 solute carrier family 41 member 1 2 2
MIRT653912 SERPINC1 serpin family C member 1 2 2
MIRT654111 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654153 RORB RAR related orphan receptor B 2 2
MIRT654548 RAB14 RAB14, member RAS oncogene family 2 2
MIRT654920 POLR3D RNA polymerase III subunit D 2 2
MIRT655169 PHF19 PHD finger protein 19 2 2
MIRT655412 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT655784 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT655836 NGDN neuroguidin 2 2
MIRT656079 MTA3 metastasis associated 1 family member 3 2 2
MIRT656404 MCTP1 multiple C2 and transmembrane domain containing 1 2 2
MIRT656720 LMLN leishmanolysin like peptidase 2 2
MIRT656774 LARP1 La ribonucleoprotein domain family member 1 2 2
MIRT656922 KIAA1462 junctional cadherin 5 associated 2 2
MIRT657004 KCNMB4 potassium calcium-activated channel subfamily M regulatory beta subunit 4 2 2
MIRT657477 HCAR2 hydroxycarboxylic acid receptor 2 2 2
MIRT657539 GSTO2 glutathione S-transferase omega 2 2 2
MIRT657911 GCC1 GRIP and coiled-coil domain containing 1 2 2
MIRT658478 EXOC8 exocyst complex component 8 2 2
MIRT658612 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT658823 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT658965 DNAJB5 DnaJ heat shock protein family (Hsp40) member B5 2 4
MIRT659706 CCDC93 coiled-coil domain containing 93 2 2
MIRT660034 C15orf61 chromosome 15 open reading frame 61 2 2
MIRT660108 BTBD3 BTB domain containing 3 2 2
MIRT660697 AMOTL2 angiomotin like 2 2 2
MIRT660763 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT660884 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT660956 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT661217 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT661596 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT661624 UGT2B28 UDP glucuronosyltransferase family 2 member B28 2 2
MIRT662430 EID2 EP300 interacting inhibitor of differentiation 2 2 2
MIRT664816 NOX5 NADPH oxidase 5 2 2
MIRT665548 UCHL5 ubiquitin C-terminal hydrolase L5 2 2
MIRT665815 TMEM161B transmembrane protein 161B 2 2
MIRT666668 RBM23 RNA binding motif protein 23 2 2
MIRT667995 HCFC2 host cell factor C2 2 2
MIRT668064 GPR180 G protein-coupled receptor 180 2 2
MIRT669056 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT669637 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT699368 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699882 RUNX1 runt related transcription factor 1 2 2
MIRT703834 ETV3 ETS variant 3 2 2
MIRT708528 ZNF177 zinc finger protein 177 2 2
MIRT709696 DMWD DM1 locus, WD repeat containing 2 2
MIRT710381 PARD6G par-6 family cell polarity regulator gamma 2 2
MIRT710639 GLUL glutamate-ammonia ligase 2 2
MIRT711584 SETD1A SET domain containing 1A 2 2
MIRT713208 FAM13A family with sequence similarity 13 member A 2 2
MIRT714129 IL20RB interleukin 20 receptor subunit beta 2 2
MIRT714204 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT714733 CCNO cyclin O 2 2
MIRT714761 ZNF462 zinc finger protein 462 2 2
MIRT715624 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT715755 SKA2 spindle and kinetochore associated complex subunit 2 2 2
MIRT716075 RNF150 ring finger protein 150 2 2
MIRT716179 MTRNR2L1 MT-RNR2-like 1 2 2
MIRT717450 RWDD2A RWD domain containing 2A 2 2
MIRT717866 CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 2 2
MIRT720964 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT721564 SLC5A12 solute carrier family 5 member 12 2 2
MIRT722348 BAG2 BCL2 associated athanogene 2 2 2
MIRT723235 BTLA B and T lymphocyte associated 2 2
MIRT724018 LMBRD2 LMBR1 domain containing 2 2 2
MIRT724507 KLHL5 kelch like family member 5 2 2
MIRT725478 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4446 Aed Therapy sensitive High Epilepsy tissue
hsa-mir-4446 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-4446 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-4446 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-4446 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4446 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-4446-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4446-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4446-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4446-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission