pre-miRNA Information
pre-miRNA hsa-mir-1245b   
Genomic Coordinates chr2: 188978093 - 188978161
Description Homo sapiens miR-1245b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1245b-3p
Sequence 42| UCAGAUGAUCUAAAGGCCUAUA |63
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs748755619 4 dbSNP
rs1270331859 8 dbSNP
rs1424666827 9 dbSNP
rs777446442 11 dbSNP
rs568426204 21 dbSNP
Putative Targets

Gene Information
Gene Symbol ONECUT3
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7 PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000382349.4 | 3UTR | CUCUCCCCCGCUCCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
62 hsa-miR-1245b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT087132 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT093398 TMA16 translation machinery associated 16 homolog 2 2
MIRT096092 SFXN1 sideroflexin 1 2 2
MIRT097106 TNPO1 transportin 1 2 4
MIRT241837 SLC38A2 solute carrier family 38 member 2 2 2
MIRT271432 ETNK1 ethanolamine kinase 1 2 2
MIRT329517 E2F3 E2F transcription factor 3 2 4
MIRT444201 SESN3 sestrin 3 2 2
MIRT445920 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT450210 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT455192 AGTRAP angiotensin II receptor associated protein 2 2
MIRT455458 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT459016 UQCRH ubiquinol-cytochrome c reductase hinge protein 2 2
MIRT461492 KIAA1009 centrosomal protein 162 1 1
MIRT466306 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT471143 PHF19 PHD finger protein 19 2 2
MIRT473481 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT473564 MATR3 matrin 3 2 2
MIRT474013 LRRC20 leucine rich repeat containing 20 2 2
MIRT475982 GTPBP2 GTP binding protein 2 2 2
MIRT478926 CPNE3 copine 3 2 2
MIRT479896 CCDC117 coiled-coil domain containing 117 2 2
MIRT480115 CALR calreticulin 2 2
MIRT483127 ONECUT3 one cut homeobox 3 2 2
MIRT484236 IER2 immediate early response 2 2 2
MIRT492237 SLC48A1 solute carrier family 48 member 1 2 2
MIRT496934 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT500438 ZMAT3 zinc finger matrin-type 3 2 2
MIRT506263 PDPK1 3-phosphoinositide dependent protein kinase 1 2 2
MIRT525649 NHSL2 NHS like 2 2 2
MIRT526691 BAK1 BCL2 antagonist/killer 1 2 2
MIRT529667 SLC28A1 solute carrier family 28 member 1 2 2
MIRT531152 CYGB cytoglobin 2 2
MIRT537002 GTPBP10 GTP binding protein 10 2 2
MIRT537325 FOXN3 forkhead box N3 2 2
MIRT537586 ESYT2 extended synaptotagmin 2 2 2
MIRT538786 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT540286 RGR retinal G protein coupled receptor 2 4
MIRT552700 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT555670 PGAM4 phosphoglycerate mutase family member 4 2 2
MIRT556823 KDELR2 KDEL endoplasmic reticulum protein retention receptor 2 2 2
MIRT568686 TOMM40 translocase of outer mitochondrial membrane 40 2 2
MIRT568851 VPS53 VPS53, GARP complex subunit 2 2
MIRT571973 KIF21A kinesin family member 21A 2 2
MIRT573973 DDX21 DExD-box helicase 21 2 2
MIRT574260 DOCK7 dedicator of cytokinesis 7 2 2
MIRT612180 EMC3 ER membrane protein complex subunit 3 2 2
MIRT619387 KLHL12 kelch like family member 12 2 2
MIRT625708 SHROOM1 shroom family member 1 2 2
MIRT646803 EVC2 EvC ciliary complex subunit 2 2 2
MIRT656992 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT676250 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT682591 CPA4 carboxypeptidase A4 2 2
MIRT687779 KHSRP KH-type splicing regulatory protein 2 2
MIRT690292 ZNF154 zinc finger protein 154 2 2
MIRT692718 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT700284 RAN RAN, member RAS oncogene family 2 2
MIRT708293 ZNF24 zinc finger protein 24 2 2
MIRT709767 GPR183 G protein-coupled receptor 183 2 2
MIRT720689 LY6K lymphocyte antigen 6 family member K 2 2
MIRT722784 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT725414 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1245b-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-1245b-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-1245b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1245b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1245b-3p Palbociclib 5330286 NSC758247 approved sensitive tissue (breast cancer)
hsa-miR-1245b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-1245b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-1245b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-1245b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-1245b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission