| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4666a |
| Genomic Coordinates | chr1: 228462074 - 228462152 |
| Description | Homo sapiens miR-4666a stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4666a-5p | |||||||||||||||||||||||||||
| Sequence | 10| AUACAUGUCAGAUUGUAUGCC |30 | |||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||
| Experiments | Illumina | |||||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | C2orf72 | ||||||||||||||||||||
| Synonyms | - | ||||||||||||||||||||
| Description | chromosome 2 open reading frame 72 | ||||||||||||||||||||
| Transcript | NM_001144994 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on C2orf72 | |||||||||||||||||||||
| 3'UTR of C2orf72 (miRNA target sites are highlighted) |
>C2orf72|NM_001144994|3'UTR 1 AGGCTGGACCCTTGCGCTGTCCCTGGCTCTAACCTACAGACTGGGGCCTGGCTCCGTCTTACTGGCCCCCAGGTCTCCAT 81 GGAGACTGCAGAAACCCCCGCCTGCTGGAGGCCTGCCACACTCACAGTTACCAGCTAGACAGTGGGGCTTACTAAGACAA 161 GCAGGACCTAAAACAGTGTCTCCCCTGGGAACCTACTCCCCACCCAGCATTTGCTAAGTCTGATCACAGGGAGGTTATTT 241 TGTCTCTCTGTCTCGGTTTCTCTGAGCCACTGAGACAGATGGCTGTCCGCTTTGAGGCTCTGCAGAGCTGTGGCACCCCA 321 TGGTGTGTCTGCAGTGTTCTGGGCACATGCATGGGCACCCATCGTTGAGAGTGCAGCTGGGAAGAACTCTGAACCAGAAG 401 TCATCAGAGCTGAGGCATGGCCTTGAACATGTCACTCAGTCTCTGGGGCTTCTGTTTCACAAATGCATGAGGGGGCCACC 481 AGCCCAGTGGCTTTAAACCAGGGGCAGGTTGTCCCTCCAGGCAGCATTGGAAATGTGTGTGTGTTGAGGGGGTCACAGTG 561 ACTGTGGGGGCACCCCTGGCATCTAGTGGGCATCCCACAATGTGCAGAACAGTCTCTGACAGCAAAGAATTGGTCCATTC 641 AATGCCAATTGTAGTACCTTTGAGACATTCTGGCTGAGCCAATGCCTTCTCCCTGTCAGAGTCCCCCAGAGCAGAGAGGG 721 TCAGGCTTCCCTGGACCTTGGCTCCCAGAGCAAGCCAAAATAAAGACTACACTGTTGCCTTGGGGGCTTGTCGGGCCAGG 801 GCCAAGACGGTCTGCGTGCTGCAGGGCCAGGACAGAAATAGCCACACATGCCGGTGAGAACAAAGAGCCTCTTTCTTTCT 881 CATGTTGACATCGACTTTCTGTGCCAAGTCCTTTGGGTATAAGGATGCTAGGGAATTCCTATAGGCACCAAACAGAAGGA 961 AAGCTAGGGGCTTGGACTACTGGGTATAGGACTTGCTCTAGCTCTCAGGTCCTAGCCCAAGCTCAATGCAAACACAGCCC 1041 CTCCGGGCTCTCTGTTTCTGTGAGGTTCTGGAATCCCTTCCTCTGTGTCCGTGAGTCTGACAGAATCGATGATGTTCCCT 1121 TAGAGCTGGGAAATCCATGTGTTTATTCACGGAGGGAACTCACCATTACCTCCCTTGTCTTCTTTGCCTGCCTTGGAGAA 1201 ATCCAGAGTCTTCGGAATGGCAAAGGCAGCTCCTGGATTTCCCTGGAGGGGAGGCACTAGCTGAGGGAAGTAGCTCCCTT 1281 CATTCATGATGCACAGTTTACGCAGCAGACACACAACTGCGCCTACTATTTGCTCGGTGCCCTGCAAGGTGCTGCCTAAC 1361 TTTGATTTGTTATTTCAGCTCTCTCCAGGATAGTGCCAAATGGTGCAATGGGAAACCTGTTTTGCTGGGGGGCTCTAGAT 1441 CACTGGCTCCAGAACTCCCGGCTGCCAGGGTAGCCCCTACCCCCAGCCCCTTGCTCCTGGACAGCAGTGGGTCTCACCTT 1521 TAGCCTCTGCCCCCAGTTCTGGTCTGACCCAACAGAGGGGCTCTATGATATTAAGAAGGGGCCCTTCCTGCTCTGTGCCT 1601 CAACCTATTCTCCATAATAGGGAGTCTAATCCTATTCCTTCCCTGCCTGATGAGGATGGTGTGAGGATGAGGAGGACGGC 1681 ATCTCATTTGGGGCTTTTTGGCAGTGGGCCTCATTTTAATCCTGCAGGGCTGCCTGCCAGTGGATCTATCCAGCTGCTTC 1761 CTTGTAGCCAAGAATGAGTTCAATGAATTGTGATTCACTGATTTTATTGATTTTGTTTTAAAACAGGGAGACTGGTATTT 1841 TTGAAGCTGCTATCATTTTCTATTTCTTTATTAATTTCTTTGTAATCATCTTATTAAAGTTTTCTTATTTAGTGGGAGAG 1921 GGAGCTTTGTTTAAGTTTGGAATTTGCCTAAGGCAGAAGTTATAAGGCTTCATAACCTTTTGTATGTATTGCCAATATTT 2001 GAAACTTGGGAGATTACGTATAAAAAATACCTAGTTTTCTGGGTGGAGGATGGGGCATGCTGTCATCTCAAGTCTGCTGC 2081 GGCTCACCCCCACCACCTTTACCCCCTCCCCCGCCCTTCCCATCCCCCACTGCACTTCACTCATGTAAGACGTCTGCCCG 2161 GTGCTGGTCCAGGCGGGCATGTGAGTTTGTAGCCTCTGCTCCAAAGGATGGTTTACACATTATTTTTTCATTACCTTCAG 2241 TATTCCTGTGAATGGTTCAAGAGAGAAAGTCTTCATTTACTAAGATTTGGGTTCTGCCTCCCAAGTGACAATACGGGGCT 2321 GAGATCCCTCTCAGCTTCTTTGAGATGTGGCCACCATAAGCATCATCGTTGTAGGGACAGTCTCATTGCTGTCTTCTAGC 2401 AGACAGAAGAGTTAGGTGCCAGAAAGGACAATCTTGATGGTGGGTCCCCTCCCTGAAGGACTTTAAGAAGGCATAAAGGG 2481 GTTGGGGTGGAGGGTGGCGTGTGAAGGAGGAGGCCCTTGATTAGGTCAGTGGTCCCTGGGAGCCATCGGCGAGAGGCCTC 2561 CAGCCGGGTGACAGTCTGGGCTCTCGGGTACTAATCTTTCTAATATGGCAGTGGTTGTGGCACTTCTGACTTGAATTGAT 2641 AATTCTCATATCTAATAAAACCAAGAAGTACCTCGTTGATATCTTATAGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 257407.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 257407.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 , TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000373640.4 | 3UTR | AGACGUCUGCCCGGUGCUGGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000373640.4 | 3UTR | AGACGUCUGCCCGGUGCUGGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000373640.4 | 3UTR | GUAAGACGUCUGCCCGGUGCUGGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000373640.4 | 3UTR | AGACGUCUGCCCGGUGCUGGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000373640.4 | 3UTR | AGACGUCUGCCCGGUGCUGGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000373640.4 | 3UTR | AGACGUCUGCCCGGUGCUGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1462573 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl BaL |
| Location of target site | ENST00000373640.4 | 3UTR | GUAAGACGUCUGCCCGGUGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
83 hsa-miR-4666a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT057266 | FAM35A | family with sequence similarity 35 member A |  |
|
2 | 2 | ||||||
| MIRT059969 | PATL1 | PAT1 homolog 1, processing body mRNA decay factor | |
|
2 | 6 | ||||||
| MIRT079031 | TNRC6C | trinucleotide repeat containing 6C | |
|
2 | 2 | ||||||
| MIRT079631 | DNAJB4 | DnaJ heat shock protein family (Hsp40) member B4 | |
|
2 | 2 | ||||||
| MIRT086974 | LANCL1 | LanC like 1 | |
|
2 | 2 | ||||||
| MIRT091804 | GOLGA4 | golgin A4 | |
|
2 | 2 | ||||||
| MIRT229501 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | |
|
2 | 4 | ||||||
| MIRT255972 | WDR17 | WD repeat domain 17 | |
|
2 | 2 | ||||||
| MIRT262975 | ADO | 2-aminoethanethiol dioxygenase | |
|
2 | 2 | ||||||
| MIRT264774 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT334169 | CCND1 | cyclin D1 | |
|
2 | 6 | ||||||
| MIRT345868 | SRSF2 | serine and arginine rich splicing factor 2 | |
|
2 | 2 | ||||||
| MIRT452477 | DDX4 | DEAD-box helicase 4 | |
|
2 | 2 | ||||||
| MIRT455764 | TSPAN6 | tetraspanin 6 | |
|
2 | 4 | ||||||
| MIRT461627 | DCAF15 | DDB1 and CUL4 associated factor 15 | |
|
2 | 4 | ||||||
| MIRT465169 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | |
|
2 | 4 | ||||||
| MIRT468950 | RPS14 | ribosomal protein S14 | |
|
2 | 6 | ||||||
| MIRT483236 | C2orf72 | chromosome 2 open reading frame 72 | |
|
2 | 8 | ||||||
| MIRT498544 | TMEM30B | transmembrane protein 30B | |
|
2 | 2 | ||||||
| MIRT500633 | TXNIP | thioredoxin interacting protein | |
|
2 | 4 | ||||||
| MIRT504113 | GPR158 | G protein-coupled receptor 158 | |
|
2 | 2 | ||||||
| MIRT504428 | ZNF85 | zinc finger protein 85 | |
|
2 | 6 | ||||||
| MIRT505036 | ZNF451 | zinc finger protein 451 | |
|
2 | 2 | ||||||
| MIRT506526 | MRPL17 | mitochondrial ribosomal protein L17 | |
|
2 | 6 | ||||||
| MIRT508773 | GSG1 | germ cell associated 1 | |
|
2 | 2 | ||||||
| MIRT517297 | ELF4 | E74 like ETS transcription factor 4 | |
|
2 | 6 | ||||||
| MIRT519353 | OBFC1 | STN1, CST complex subunit | |
|
2 | 4 | ||||||
| MIRT523891 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | |
|
2 | 6 | ||||||
| MIRT527509 | ZNF134 | zinc finger protein 134 | |
|
2 | 2 | ||||||
| MIRT531218 | IFNGR2 | interferon gamma receptor 2 | |
|
2 | 2 | ||||||
| MIRT535957 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT537229 | GALNT7 | polypeptide N-acetylgalactosaminyltransferase 7 | |
|
2 | 4 | ||||||
| MIRT537337 | FKBP5 | FK506 binding protein 5 | |
|
2 | 2 | ||||||
| MIRT539125 | ARHGEF17 | Rho guanine nucleotide exchange factor 17 | |
|
2 | 2 | ||||||
| MIRT539910 | ISPD | isoprenoid synthase domain containing | |
|
2 | 2 | ||||||
| MIRT541527 | MGAT4C | MGAT4 family member C | |
|
2 | 2 | ||||||
| MIRT546119 | USP25 | ubiquitin specific peptidase 25 | |
|
2 | 2 | ||||||
| MIRT548846 | CERCAM | cerebral endothelial cell adhesion molecule | |
|
2 | 2 | ||||||
| MIRT549892 | LINC00955 | long intergenic non-protein coding RNA 955 | |
|
2 | 2 | ||||||
| MIRT549898 | ADH4 | alcohol dehydrogenase 4 (class II), pi polypeptide | |
|
2 | 2 | ||||||
| MIRT550763 | ENOX2 | ecto-NOX disulfide-thiol exchanger 2 | |
|
2 | 4 | ||||||
| MIRT553200 | UBE2A | ubiquitin conjugating enzyme E2 A | |
|
2 | 2 | ||||||
| MIRT553970 | SRSF10 | serine and arginine rich splicing factor 10 | |
|
2 | 2 | ||||||
| MIRT554092 | SMU1 | DNA replication regulator and spliceosomal factor | |
|
2 | 2 | ||||||
| MIRT555208 | PROX1 | prospero homeobox 1 | |
|
2 | 4 | ||||||
| MIRT555834 | PAX5 | paired box 5 | |
|
2 | 4 | ||||||
| MIRT556865 | JAZF1 | JAZF zinc finger 1 | |
|
2 | 2 | ||||||
| MIRT558594 | CREBL2 | cAMP responsive element binding protein like 2 | |
|
2 | 2 | ||||||
| MIRT559690 | AGO2 | argonaute 2, RISC catalytic component | |
|
2 | 4 | ||||||
| MIRT563312 | ORC4 | origin recognition complex subunit 4 | |
|
2 | 2 | ||||||
| MIRT563585 | FAM229B | family with sequence similarity 229 member B | |
|
2 | 2 | ||||||
| MIRT563853 | ALYREF | Aly/REF export factor | |
|
2 | 4 | ||||||
| MIRT565146 | TUBB2A | tubulin beta 2A class IIa | |
|
2 | 2 | ||||||
| MIRT565769 | SEPHS1 | selenophosphate synthetase 1 | |
|
2 | 2 | ||||||
| MIRT568317 | BACH1 | BTB domain and CNC homolog 1 | |
|
2 | 2 | ||||||
| MIRT575387 | Unc5b | unc-5 netrin receptor B | |
|
2 | 4 | ||||||
| MIRT607728 | BDH1 | 3-hydroxybutyrate dehydrogenase 1 | |
|
2 | 8 | ||||||
| MIRT612691 | PLXNA4 | plexin A4 | |
|
2 | 4 | ||||||
| MIRT615916 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT629792 | P2RY1 | purinergic receptor P2Y1 | |
|
2 | 2 | ||||||
| MIRT632119 | FKBP9 | FK506 binding protein 9 | |
|
2 | 2 | ||||||
| MIRT645554 | ZDHHC15 | zinc finger DHHC-type containing 15 | |
|
2 | 4 | ||||||
| MIRT651479 | WWC3 | WWC family member 3 | |
|
2 | 2 | ||||||
| MIRT654138 | RPH3A | rabphilin 3A | |
|
2 | 6 | ||||||
| MIRT655191 | PHAX | phosphorylated adaptor for RNA export | |
|
2 | 2 | ||||||
| MIRT665543 | UNC5B | unc-5 netrin receptor B | |
|
2 | 5 | ||||||
| MIRT668057 | GRIK3 | glutamate ionotropic receptor kainate type subunit 3 | |
|
2 | 2 | ||||||
| MIRT678978 | CERS4 | ceramide synthase 4 | |
|
2 | 4 | ||||||
| MIRT679124 | RBM3 | RNA binding motif (RNP1, RRM) protein 3 | |
|
2 | 2 | ||||||
| MIRT686776 | AZF1 | azoospermia factor 1 | |
|
2 | 2 | ||||||
| MIRT687144 | PTPN12 | protein tyrosine phosphatase, non-receptor type 12 | |
|
2 | 2 | ||||||
| MIRT691453 | C21orf58 | chromosome 21 open reading frame 58 | |
|
2 | 2 | ||||||
| MIRT691469 | FAM98B | family with sequence similarity 98 member B | |
|
2 | 2 | ||||||
| MIRT697031 | UHRF1BP1 | UHRF1 binding protein 1 | |
|
2 | 2 | ||||||
| MIRT698401 | TM9SF3 | transmembrane 9 superfamily member 3 | |
|
2 | 2 | ||||||
| MIRT702056 | RNMT | RNA guanine-7 methyltransferase | |
|
2 | 2 | ||||||
| MIRT705903 | ADAM9 | ADAM metallopeptidase domain 9 | |
|
2 | 2 | ||||||
| MIRT707491 | MMADHC | methylmalonic aciduria and homocystinuria, cblD type | |
|
2 | 2 | ||||||
| MIRT708080 | KLHL23 | kelch like family member 23 | |
|
2 | 2 | ||||||
| MIRT709738 | TRIM27 | tripartite motif containing 27 | |
|
2 | 2 | ||||||
| MIRT710056 | RWDD2A | RWD domain containing 2A | |
|
2 | 2 | ||||||
| MIRT710226 | KCNK1 | potassium two pore domain channel subfamily K member 1 | |
|
2 | 2 | ||||||
| MIRT712043 | STYK1 | serine/threonine/tyrosine kinase 1 | |
|
2 | 2 | ||||||