pre-miRNA Information
pre-miRNA hsa-mir-4271   
Genomic Coordinates chr3: 49274120 - 49274186
Description Homo sapiens miR-4271 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4271
Sequence 39| GGGGGAAGAAAAGGUGGGG |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30481495 1 COSMIC
COSN31532060 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760829741 1 dbSNP
rs1277951968 2 dbSNP
rs189148716 3 dbSNP
rs757021935 4 dbSNP
rs1285201145 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CITED4   
Synonyms -
Description Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4
Transcript NM_133467   
Expression
Putative miRNA Targets on CITED4
3'UTR of CITED4
(miRNA target sites are highlighted)
>CITED4|NM_133467|3'UTR
   1 GGGCGGCCGGCGCCCGCCCGGCGTGCCGGAGAGGAGAAAGGGCCCGACTGCCCGCCGGACCCTGCACCCAGCGACTGGGC
  81 CCCGCGCGCGCCCTCCGCGAGGGTGGAGGCGGCGGCTGTGTGCGCAGGGCCCGGCACCGGACTGGGACCCTGGCGTCCCT
 161 CCAGGCCTTGCCTCCTGCGGGAGGACAGTTTGGCTTCACTTCTCTGACCCCAGCCTCGGCCGTAAAGTGAAAGAGACCGG
 241 ACCAGCTTCAGCTTTCGGACTCTGGTTCTTGGATCGTGTCCTCTCCCCCTCGCCGCCCTCTTCCCCCAATCTGAGCCATT
 321 GCAGGCCTCTGCCTGCTGCCCCCTCTCTCCTCGGGATCGGGTCCCCAGAGCCACCATCTCCTGAGCCTCCCACCCCGCTG
 401 CCTGGGCCCTGTGGTTGCTGGGCCTCCCACCTCAAGGAGGGGAAGGTTGTACAGCCCGAACCCGTGGAGCAATGCCCTGT
 481 CTGGCCTCCAAAACCAAAATAAAACTGGGTCACTTTAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            ||:||   |||||||| 
Target 5' cgCCGCC--CTCTTCCCCc 3'
291 - 307 153.00 -25.00
2
miRNA  3' ggggugGAAAAGAAGGGGg 5'
                |||  ||||:|: 
Target 5' gtttggCTTCACTTCTCTg 3'
188 - 206 117.00 -8.50
3
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            |::||  | || |||| 
Target 5' ctCTGCC--TGCTGCCCCc 3'
327 - 343 117.00 -20.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20073668 72 COSMIC
COSN22324317 217 COSMIC
COSN30173140 229 COSMIC
COSN31551818 291 COSMIC
COSN8469522 293 COSMIC
COSN31551809 329 COSMIC
COSN30176530 355 COSMIC
COSN28832244 359 COSMIC
COSN19221969 512 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1185655454 1 dbSNP
rs762855008 2 dbSNP
rs1436337759 5 dbSNP
rs1243811620 6 dbSNP
rs776352281 8 dbSNP
rs769468824 10 dbSNP
rs1284113530 11 dbSNP
rs1330399592 14 dbSNP
rs563742090 15 dbSNP
rs544073723 16 dbSNP
rs1167742634 19 dbSNP
rs1282108929 20 dbSNP
rs1360843908 27 dbSNP
rs916181387 30 dbSNP
rs1334398810 32 dbSNP
rs1244759689 41 dbSNP
rs1399366519 45 dbSNP
rs920945560 48 dbSNP
rs979466430 52 dbSNP
rs938722548 57 dbSNP
rs1268257174 59 dbSNP
rs575184826 60 dbSNP
rs1346850135 66 dbSNP
rs555253951 69 dbSNP
rs1279612180 70 dbSNP
rs1165500546 71 dbSNP
rs1473351267 72 dbSNP
rs1265393506 75 dbSNP
rs1478464529 77 dbSNP
rs977541545 81 dbSNP
rs913672724 83 dbSNP
rs987872148 87 dbSNP
rs960551164 88 dbSNP
rs914624623 92 dbSNP
rs1191427589 94 dbSNP
rs1466448291 98 dbSNP
rs989996811 99 dbSNP
rs1248809974 100 dbSNP
rs369084933 101 dbSNP
rs1332693961 103 dbSNP
rs1233730041 107 dbSNP
rs1467185328 109 dbSNP
rs963848705 117 dbSNP
rs1018215724 124 dbSNP
rs980692765 125 dbSNP
rs1204565707 126 dbSNP
rs755662114 127 dbSNP
rs969672108 132 dbSNP
rs1394835545 138 dbSNP
rs955103468 139 dbSNP
rs1380457358 140 dbSNP
rs1027570524 148 dbSNP
rs1286557169 154 dbSNP
rs1025732168 157 dbSNP
rs1387251459 160 dbSNP
rs993757187 160 dbSNP
rs1268229820 162 dbSNP
rs574045500 167 dbSNP
rs1311749800 171 dbSNP
rs1365487272 173 dbSNP
rs1238450237 174 dbSNP
rs1038059735 175 dbSNP
rs554284528 181 dbSNP
rs1006366424 183 dbSNP
rs1015655273 184 dbSNP
rs894620300 185 dbSNP
rs1252834470 189 dbSNP
rs1180836460 191 dbSNP
rs1238426495 195 dbSNP
rs72949149 196 dbSNP
rs1406487237 205 dbSNP
rs891304763 207 dbSNP
rs1458401882 209 dbSNP
rs938929161 210 dbSNP
rs571624776 213 dbSNP
rs928862787 217 dbSNP
rs992243548 219 dbSNP
rs1051169012 221 dbSNP
rs1331732216 231 dbSNP
rs946003485 233 dbSNP
rs932905825 237 dbSNP
rs1391017148 238 dbSNP
rs1305031138 239 dbSNP
rs914678782 245 dbSNP
rs551824550 249 dbSNP
rs990215622 256 dbSNP
rs963940634 264 dbSNP
rs1333264951 270 dbSNP
rs911040934 278 dbSNP
rs1259070742 280 dbSNP
rs538505146 283 dbSNP
rs1043972152 285 dbSNP
rs946399566 289 dbSNP
rs1423895065 290 dbSNP
rs1025484035 292 dbSNP
rs752204726 295 dbSNP
rs1467085502 298 dbSNP
rs1171186069 299 dbSNP
rs987904613 300 dbSNP
rs962333985 301 dbSNP
rs939049940 303 dbSNP
rs1404541006 305 dbSNP
rs1415494653 307 dbSNP
rs1292705033 308 dbSNP
rs1354155131 325 dbSNP
rs1220983007 327 dbSNP
rs1057641 329 dbSNP
rs1296818998 344 dbSNP
rs1016666053 346 dbSNP
rs927784438 348 dbSNP
rs1452703701 349 dbSNP
rs980640596 350 dbSNP
rs1257408333 356 dbSNP
rs12044255 359 dbSNP
rs1222346454 363 dbSNP
rs549290196 374 dbSNP
rs1478794727 377 dbSNP
rs116153784 378 dbSNP
rs973324102 381 dbSNP
rs1426532051 386 dbSNP
rs1270726740 393 dbSNP
rs1207103064 395 dbSNP
rs963050857 396 dbSNP
rs1034933541 397 dbSNP
rs1435535699 397 dbSNP
rs1342596453 398 dbSNP
rs1015519648 399 dbSNP
rs1402473151 401 dbSNP
rs1279207523 405 dbSNP
rs1289976564 407 dbSNP
rs1004259871 409 dbSNP
rs891168813 410 dbSNP
rs1029698352 431 dbSNP
rs1348205679 437 dbSNP
rs1233091684 440 dbSNP
rs1277656054 442 dbSNP
rs1488987156 447 dbSNP
rs559254344 449 dbSNP
rs907460611 449 dbSNP
rs1274962787 455 dbSNP
rs1241465484 457 dbSNP
rs751180475 463 dbSNP
rs997456100 464 dbSNP
rs1335702683 470 dbSNP
rs1454917198 475 dbSNP
rs946055713 479 dbSNP
rs766179331 480 dbSNP
rs899981749 488 dbSNP
rs1212860401 501 dbSNP
rs1432089140 506 dbSNP
rs893129400 507 dbSNP
rs762720601 511 dbSNP
rs1351401577 514 dbSNP
rs1011131060 516 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_133467 | 3UTR | CUCGCCGCCCUCUUCCCCCAAUCUGAGCCAUUGCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903826
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_NS
Location of target site NM_133467 | 3UTR | CGGACUCUGGUUCUUGGAUCGUGUCCUCUCCCCCUCGCCGCCCUCUUCCCCCAAUCUGAGCCAUUGCAGGCCUCUGCCUGCUGCCCCCUCUCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000372638.2 | 3UTR | CCUCUCCCCCUCGCCGCCCUCUUCCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000372638.2 | 3UTR | CGCCGCCCUCUUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000372638.2 | 3UTR | CCUCUCCCCCUCGCCGCCCUCUUCCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000372638.2 | 3UTR | CUCUCCCCCUCGCCGCCCUCUUCCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000372638.2 | 3UTR | UCUCCCCCUCGCCGCCCUCUUCCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
181 hsa-miR-4271 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066209 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT079367 CCDC137 coiled-coil domain containing 137 2 2
MIRT081183 MIDN midnolin 2 4
MIRT083278 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT086207 HOXD13 homeobox D13 2 2
MIRT133713 SKI SKI proto-oncogene 2 4
MIRT150653 SLC27A1 solute carrier family 27 member 1 2 2
MIRT159166 NRBP1 nuclear receptor binding protein 1 2 2
MIRT160059 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT180856 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT181931 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT190628 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190654 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT196107 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT263248 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT321168 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT338624 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT366301 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375172 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT441488 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT442333 WNT9B Wnt family member 9B 2 2
MIRT443889 CNKSR3 CNKSR family member 3 2 2
MIRT445880 WBP1L WW domain binding protein 1 like 2 2
MIRT449312 MRO maestro 2 2
MIRT449844 BCL2L13 BCL2 like 13 2 2
MIRT450304 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT450515 EMX1 empty spiracles homeobox 1 2 2
MIRT451243 ZNF444 zinc finger protein 444 2 2
MIRT451713 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451792 TLR5 toll like receptor 5 2 2
MIRT451823 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT451906 ILK integrin linked kinase 2 2
MIRT452181 KIAA1456 KIAA1456 2 4
MIRT452242 TRAM1 translocation associated membrane protein 1 2 2
MIRT452544 ZNF467 zinc finger protein 467 2 2
MIRT452605 REPIN1 replication initiator 1 2 2
MIRT454505 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT454657 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT455354 KDM5C lysine demethylase 5C 2 2
MIRT455452 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455587 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT456501 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT456815 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457425 NOL10 nucleolar protein 10 2 2
MIRT457468 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457660 SERINC1 serine incorporator 1 2 2
MIRT458231 NXPH3 neurexophilin 3 2 2
MIRT458374 ITM2C integral membrane protein 2C 2 2
MIRT458667 GPR35 G protein-coupled receptor 35 2 2
MIRT459665 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459825 TPP1 tripeptidyl peptidase 1 2 2
MIRT460564 FEM1A fem-1 homolog A 2 2
MIRT460725 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT461121 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461529 C14orf1 ergosterol biosynthesis 28 homolog 2 2
MIRT461750 DDX11 DEAD/H-box helicase 11 2 2
MIRT462570 STS steroid sulfatase 2 2
MIRT462798 NTN1 netrin 1 2 2
MIRT463030 ZNF689 zinc finger protein 689 2 2
MIRT463991 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT464684 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465439 TP53 tumor protein p53 2 2
MIRT465512 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465649 TNPO2 transportin 2 2 10
MIRT465947 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466028 TMEM189 transmembrane protein 189 2 2
MIRT468076 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT468131 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468498 SESN2 sestrin 2 2 2
MIRT468879 RREB1 ras responsive element binding protein 1 2 2
MIRT469318 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469558 RARA retinoic acid receptor alpha 2 2
MIRT469793 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469896 PTRF caveolae associated protein 1 2 2
MIRT470235 PRRC2A proline rich coiled-coil 2A 2 2
MIRT470808 PLXND1 plexin D1 2 2
MIRT471597 PAQR5 progestin and adipoQ receptor family member 5 2 10
MIRT471710 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT471752 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 2
MIRT472978 MRRF mitochondrial ribosome recycling factor 2 2
MIRT473538 MAX MYC associated factor X 2 2
MIRT473581 MAT2A methionine adenosyltransferase 2A 2 2
MIRT473970 LRRC58 leucine rich repeat containing 58 2 2
MIRT474223 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT474553 KLHDC3 kelch domain containing 3 2 2
MIRT474777 KIAA0895L KIAA0895 like 2 2
MIRT476042 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT476438 GBA2 glucosylceramidase beta 2 2 2
MIRT477773 E2F3 E2F transcription factor 3 2 4
MIRT477946 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478782 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT479320 VPS72 vacuolar protein sorting 72 homolog 2 2
MIRT480405 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480593 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT480963 BBC3 BCL2 binding component 3 2 2
MIRT481127 AZIN1 antizyme inhibitor 1 2 4
MIRT481444 ARRB2 arrestin beta 2 2 2
MIRT481687 AR androgen receptor 2 2
MIRT481730 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482386 AEN apoptosis enhancing nuclease 2 2
MIRT482564 ABHD2 abhydrolase domain containing 2 2 2
MIRT482605 ABHD14B abhydrolase domain containing 14B 2 2
MIRT483256 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483531 TAGLN2 transgelin 2 2 2
MIRT483840 UNC5B unc-5 netrin receptor B 2 4
MIRT483935 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484414 SNX19 sorting nexin 19 2 2
MIRT484487 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484609 SIX3 SIX homeobox 3 2 6
MIRT484703 RNF11 ring finger protein 11 2 2
MIRT485244 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT485607 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485965 RTBDN retbindin 2 2
MIRT487308 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT487329 SREBF1 sterol regulatory element binding transcription factor 1 2 4
MIRT487410 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487607 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487689 CDK14 cyclin dependent kinase 14 2 2
MIRT487787 GPR20 G protein-coupled receptor 20 2 4
MIRT488026 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT488476 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT488761 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489161 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489529 MRE11A MRE11 homolog, double strand break repair nuclease 2 8
MIRT489774 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489878 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT490094 FN3K fructosamine 3 kinase 2 2
MIRT490202 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490283 ISL2 ISL LIM homeobox 2 2 2
MIRT490377 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT491035 ALPK3 alpha kinase 3 2 2
MIRT491186 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491766 ZNF385A zinc finger protein 385A 2 2
MIRT491888 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT491981 UNK unkempt family zinc finger 2 2
MIRT492400 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT493647 HDLBP high density lipoprotein binding protein 2 2
MIRT494010 DUSP9 dual specificity phosphatase 9 2 2
MIRT494167 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT495712 PADI1 peptidyl arginine deiminase 1 2 2
MIRT496873 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT499175 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT501652 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT506645 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510590 TUBB2A tubulin beta 2A class IIa 2 6
MIRT511907 FKBP1A FK506 binding protein 1A 2 2
MIRT513063 ANKRD45 ankyrin repeat domain 45 2 2
MIRT513104 DYNAP dynactin associated protein 2 2
MIRT521804 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT523520 GLUL glutamate-ammonia ligase 2 2
MIRT525085 FRK fyn related Src family tyrosine kinase 2 2
MIRT530930 SCIN scinderin 2 2
MIRT533501 TRIM71 tripartite motif containing 71 2 2
MIRT538560 CECR2 CECR2, histone acetyl-lysine reader 2 2
MIRT544556 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT555912 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT560405 TMEM69 transmembrane protein 69 2 2
MIRT560664 RTN3 reticulon 3 2 2
MIRT564061 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT565504 SP1 Sp1 transcription factor 2 2
MIRT570014 COL1A2 collagen type I alpha 2 chain 2 2
MIRT572321 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT573229 TRIM21 tripartite motif containing 21 2 2
MIRT573487 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT574137 MARVELD1 MARVEL domain containing 1 2 2
MIRT574323 ZNF703 zinc finger protein 703 2 2
MIRT620939 OSMR oncostatin M receptor 2 2
MIRT650080 MTL5 testis expressed metallothionein like protein 2 2
MIRT684553 ZNF708 zinc finger protein 708 2 2
MIRT685841 ANGEL1 angel homolog 1 2 2
MIRT688551 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT701985 MIER3 MIER family member 3 2 2
MIRT703899 EPT1 selenoprotein I 2 2
MIRT706388 MC2R melanocortin 2 receptor 2 2
MIRT707487 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711885 INSIG2 insulin induced gene 2 2 2
MIRT719164 KIF6 kinesin family member 6 2 2
MIRT721294 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT721775 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT723763 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT725485 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4271 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-4271 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4271 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-4271 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-4271 Anlotinib 25017411 NSC832523 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Icotinib 22024915 NSC800770 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Erlotinib 176870 NSC718781 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-4271 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4271 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-4271 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4271 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4271 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission