pre-miRNA Information
pre-miRNA hsa-mir-3123   
Genomic Coordinates chr1: 241132272 - 241132346
Description Homo sapiens miR-3123 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3123
Sequence 49| CAGAGAAUUGUUUAAUC |65
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 + 241132323 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1453759221 1 dbSNP
rs968575171 5 dbSNP
rs979407933 9 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RHOXF2B   
Synonyms -
Description Rhox homeobox family member 2B
Transcript NM_001099685   
Expression
Putative miRNA Targets on RHOXF2B
3'UTR of RHOXF2B
(miRNA target sites are highlighted)
>RHOXF2B|NM_001099685|3'UTR
   1 GGGATAGCCTCTGTGCCACTTTTTGCCAGAGTGTCTTTGAGCCAGATTCATATTTTGCATAGCACCCCATCAAAAGTAGT
  81 TCATCAAATGTCTATTAAACGTTTTAAAGAAAAGTACATCATTGACCCATTTTTAGGGCACTTGTAAAAATGTTTCTATA
 161 AATATGTGAAGGGTATGTACATTTGTTTTGTGTGTCACATGGGGTCAGTAAGTTCTCAATAAAAATTGTTAAGAAATGCC
 241 ATTCAAACCGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000371402.2 | 3UTR | UCUCUUCCACCCCCACCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
113 hsa-miR-3123 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058369 TBCEL tubulin folding cofactor E like 2 4
MIRT059816 EFNA1 ephrin A1 2 2
MIRT066850 TMEM19 transmembrane protein 19 2 2
MIRT071503 CALM1 calmodulin 1 2 6
MIRT073758 NUBP1 nucleotide binding protein 1 2 2
MIRT074324 TNRC6A trinucleotide repeat containing 6A 2 10
MIRT094805 LMNB1 lamin B1 2 2
MIRT099173 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT099545 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT122643 E2F3 E2F transcription factor 3 2 2
MIRT180918 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT192844 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT224984 BAG4 BCL2 associated athanogene 4 2 2
MIRT246065 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT357085 PRRC1 proline rich coiled-coil 1 2 2
MIRT378170 C5ORF51 chromosome 5 open reading frame 51 2 2
MIRT441636 KDM5A lysine demethylase 5A 2 2
MIRT441802 BCAS1 breast carcinoma amplified sequence 1 2 2
MIRT443019 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT443445 SERPINB4 serpin family B member 4 2 2
MIRT443661 SERPINB3 serpin family B member 3 2 2
MIRT443776 STS steroid sulfatase 2 2
MIRT444663 TSPAN14 tetraspanin 14 2 2
MIRT444924 KIAA1522 KIAA1522 2 2
MIRT445378 FOXO1 forkhead box O1 2 2
MIRT447920 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT449202 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT449713 TSPYL1 TSPY like 1 2 2
MIRT450403 TMEM47 transmembrane protein 47 2 2
MIRT450787 PAPOLG poly(A) polymerase gamma 2 2
MIRT451381 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT452507 WDR1 WD repeat domain 1 2 2
MIRT453264 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT454642 FAM83H family with sequence similarity 83 member H 2 2
MIRT455513 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT456709 LDB1 LIM domain binding 1 2 2
MIRT457231 AP3D1 adaptor related protein complex 3 delta 1 subunit 2 2
MIRT459235 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT460553 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT461424 CTSL2 cathepsin V 2 3
MIRT462869 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT467178 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT469233 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT474125 LIPC lipase C, hepatic type 2 2
MIRT475509 HSP90B1 heat shock protein 90 beta family member 1 2 4
MIRT478134 DHX36 DEAH-box helicase 36 2 2
MIRT481326 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 2 2
MIRT482003 AMOTL2 angiomotin like 2 2 2
MIRT482230 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT483436 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483824 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT492051 TNFSF9 TNF superfamily member 9 2 2
MIRT494114 DLX6 distal-less homeobox 6 2 2
MIRT498882 ZNF12 zinc finger protein 12 2 10
MIRT499674 NPHP3 nephrocystin 3 2 2
MIRT506932 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT509461 ZNF587 zinc finger protein 587 2 6
MIRT510048 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT514807 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT515217 CRCP CGRP receptor component 2 2
MIRT515486 INCENP inner centromere protein 2 4
MIRT517765 ZNF366 zinc finger protein 366 2 4
MIRT518216 TRMT10B tRNA methyltransferase 10B 2 2
MIRT519602 ZNF805 zinc finger protein 805 2 2
MIRT523570 GGCX gamma-glutamyl carboxylase 2 4
MIRT525795 SOD2 superoxide dismutase 2 2 2
MIRT533055 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT534218 SLC37A3 solute carrier family 37 member 3 2 4
MIRT535633 NR2E1 nuclear receptor subfamily 2 group E member 1 2 2
MIRT535863 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT536344 LEFTY1 left-right determination factor 1 2 2
MIRT537923 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT543114 SKA2 spindle and kinetochore associated complex subunit 2 2 2
MIRT544717 ZNF529 zinc finger protein 529 2 2
MIRT544847 BASP1 brain abundant membrane attached signal protein 1 2 4
MIRT545536 ARF3 ADP ribosylation factor 3 2 2
MIRT547124 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT548070 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548446 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548626 DAZAP1 DAZ associated protein 1 2 4
MIRT550259 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT551940 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552511 ZIK1 zinc finger protein interacting with K protein 1 2 4
MIRT554015 SPIRE1 spire type actin nucleation factor 1 2 2
MIRT556647 KPNA2 karyopherin subunit alpha 2 2 4
MIRT559744 ACOX1 acyl-CoA oxidase 1 2 2
MIRT560393 TMEM254 transmembrane protein 254 2 2
MIRT562234 HMGB2 high mobility group box 2 2 2
MIRT563325 ORC4 origin recognition complex subunit 4 2 2
MIRT563697 RPS26 ribosomal protein S26 2 2
MIRT565066 USP25 ubiquitin specific peptidase 25 2 2
MIRT565349 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT565624 SLC31A1 solute carrier family 31 member 1 2 2
MIRT566379 PNISR PNN interacting serine and arginine rich protein 2 2
MIRT567575 FEM1C fem-1 homolog C 2 2
MIRT569383 DDX20 DEAD-box helicase 20 2 2
MIRT570037 FAM228A family with sequence similarity 228 member A 2 2
MIRT573269 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT573912 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT620034 ST6GALNAC3 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 2 2
MIRT635606 ZWILCH zwilch kinetochore protein 2 2
MIRT644413 FRMD6 FERM domain containing 6 2 2
MIRT652528 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT656238 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT661373 DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 2 2
MIRT662530 PNPLA4 patatin like phospholipase domain containing 4 2 2
MIRT675551 MALL mal, T-cell differentiation protein like 2 2
MIRT693650 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT696348 SLC35D2 solute carrier family 35 member D2 2 2
MIRT705815 AKNA AT-hook transcription factor 2 2
MIRT707632 TARDBP TAR DNA binding protein 2 2
MIRT717902 COPS8 COP9 signalosome subunit 8 2 2
MIRT723626 SOBP sine oculis binding protein homolog 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3123 Doxorubicin 31703 NSC123127 approved sensitive High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-mir-3123 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-3123 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3123 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3123 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)

Error report submission