>CYP11A1|NM_000781|3'UTR
   1 TCAGAGAGGATGGCCTGCAGCCACATGGGAGGAAGGCCCAGGGGTGGGGCCCATGGGGTCTCTGCATCTTCAGTCGTCTG
  81 TCCCAAGTCCTGCTCCTTTCTGCCCAGCCTGCTCAGCAGGTTGAATGGGTTCTCAGTGGTCACCTTCCTCAGCTCAGCTG
 161 GGCCACTCCTCTTCACCCACCCCATGGAGACAATAAACAGCTGAACCATGAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaggucccggcuGGUGGGGUu 5' |||||||| Target 5' actcctcttcacCCACCCCAt 3'	165 - 185	145.00	-21.80
2	miRNA 3' gaGGUCCCGGCUGGUGGGGUu 5' :|| |:|| |:::|||| Target 5' ctTCA--GTCGTCTGTCCCAa 3'	68 - 86	111.00	-20.60
3	miRNA 3' gaGGUCCCGGCUGGUGGGGuu 5' :||| :|::||||:: Target 5' tcTCAG---TGGTCACCTTcc 3'	131 - 148	100.00	-16.10

Mutant ID	Mutant Position	Mutant Source
COSN30448656	6	COSMIC
COSN30150540	27	COSMIC
COSN30481763	28	COSMIC
COSN30151752	31	COSMIC
COSN30455373	31	COSMIC
COSN30142402	42	COSMIC
COSN31496540	98	COSMIC
COSN1180023	103	COSMIC
COSN31958436	109	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs755714115	2	dbSNP
rs751976437	8	dbSNP
rs1207014663	11	dbSNP
rs764631968	14	dbSNP
rs763476784	17	dbSNP
rs1020900516	18	dbSNP
rs753023774	23	dbSNP
rs1256525983	24	dbSNP
rs1013490200	25	dbSNP
rs757253866	26	dbSNP
rs1293427995	35	dbSNP
rs1055123300	36	dbSNP
rs759623238	41	dbSNP
rs1299552793	42	dbSNP
rs938131122	43	dbSNP
rs776969642	44	dbSNP
rs770912106	45	dbSNP
rs760851260	46	dbSNP
rs773262967	51	dbSNP
rs1305620997	60	dbSNP
rs1198727858	61	dbSNP
rs1378739889	68	dbSNP
rs898580861	75	dbSNP
rs571633868	76	dbSNP
rs1400107238	93	dbSNP
rs1465802575	95	dbSNP
rs1332960874	114	dbSNP
rs905274207	124	dbSNP
rs1385767790	133	dbSNP
rs550275002	135	dbSNP
rs1332740509	137	dbSNP
rs946694325	141	dbSNP
rs892438762	167	dbSNP
rs1403256975	168	dbSNP
rs1053465351	171	dbSNP
rs1199444316	177	dbSNP
rs934540267	179	dbSNP
rs531733728	180	dbSNP
rs1487517573	185	dbSNP
rs908693914	189	dbSNP
rs987038545	191	dbSNP
rs561307465	192	dbSNP
rs549658330	201	dbSNP
rs1481701355	209	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.