>ZNF354B|NM_058230|3'UTR
   1 AAGCCTTAAACCAAAACTCATCAGAGAATACATGCTTGAGAGTGATTTATTAAATATAATGAATATGAGAAAACTCTTAG
  81 TTCTCATCAGATACTAAGTTTTAAGAATAAACTTTAGCTATGTAATAACTTAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agUGUUC--ACUUCAUCACccu 5' ||| | |||: |||| Target 5' atACATGCTTGAG--AGTGatt 3'	28 - 47	87.00	-5.22

Mutant ID	Mutant Position	Mutant Source
COSN31502952	5	COSMIC
COSN28650353	62	COSMIC
COSN1312793	87	COSMIC
COSN16544902	94	COSMIC
COSN19620623	99	COSMIC
COSN31605165	106	COSMIC
COSN31531280	110	COSMIC
COSN20048142	134	COSMIC
COSN15736833	285	COSMIC
COSN21991000	313	COSMIC
COSN22818024	592	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs376195716	3	dbSNP
rs1030839060	7	dbSNP
rs752928959	11	dbSNP
rs1405016735	13	dbSNP
rs748716907	18	dbSNP
rs755921133	20	dbSNP
rs768345457	20	dbSNP
rs763734854	23	dbSNP
rs753687416	24	dbSNP
rs182051593	27	dbSNP
rs779046389	28	dbSNP
rs745342195	29	dbSNP
rs140053195	31	dbSNP
rs779747553	32	dbSNP
rs746585082	33	dbSNP
rs768360431	35	dbSNP
rs1321525521	36	dbSNP
rs773979905	38	dbSNP
rs1237689323	39	dbSNP
rs773410824	40	dbSNP
rs369181418	43	dbSNP
rs1204607405	45	dbSNP
rs771404130	50	dbSNP
rs528254971	52	dbSNP
rs1247732130	55	dbSNP
rs546462926	58	dbSNP
rs74462474	62	dbSNP
rs187659702	65	dbSNP
rs1175798130	74	dbSNP
rs919550584	78	dbSNP
rs550469209	81	dbSNP
rs985559288	84	dbSNP
rs1414616431	95	dbSNP
rs78387453	99	dbSNP
rs1231865696	104	dbSNP
rs1164469284	108	dbSNP
rs982916252	121	dbSNP
rs1407100217	123	dbSNP
rs944039116	125	dbSNP
rs1381155961	130	dbSNP
rs1382213681	134	dbSNP
rs946923186	135	dbSNP
rs1321987169	143	dbSNP
rs938881975	151	dbSNP
rs747599443	158	dbSNP
rs978108867	164	dbSNP
rs1473684688	168	dbSNP
rs76329310	177	dbSNP
rs1446490917	178	dbSNP
rs947634615	182	dbSNP
rs1210681821	184	dbSNP
rs1352065406	194	dbSNP
rs1272836613	200	dbSNP
rs936542926	209	dbSNP
rs1043071871	211	dbSNP
rs1292227157	213	dbSNP
rs1053709638	218	dbSNP
rs903144960	228	dbSNP
rs554613721	229	dbSNP
rs1229495832	231	dbSNP
rs998960231	241	dbSNP
rs1393250796	244	dbSNP
rs1052308854	245	dbSNP
rs947922169	246	dbSNP
rs890523620	247	dbSNP
rs572833440	250	dbSNP
rs1187699991	259	dbSNP
rs536000292	261	dbSNP
rs906306662	264	dbSNP
rs1190565381	265	dbSNP
rs1391989065	265	dbSNP
rs533913294	268	dbSNP
rs1163866427	271	dbSNP
rs1252604648	275	dbSNP
rs75617526	276	dbSNP
rs995790246	276	dbSNP
rs191967030	277	dbSNP
rs1195618162	283	dbSNP
rs531084787	283	dbSNP
rs1228455632	288	dbSNP
rs995682077	288	dbSNP
rs1372395407	290	dbSNP
rs982457541	304	dbSNP
rs1035426960	305	dbSNP
rs1331336943	307	dbSNP
rs1027687529	316	dbSNP
rs991654369	318	dbSNP
rs916048272	320	dbSNP
rs954228856	326	dbSNP
rs1430470343	327	dbSNP
rs1189550553	333	dbSNP
rs1394492683	333	dbSNP
rs530448228	336	dbSNP
rs979402442	340	dbSNP
rs1181509515	343	dbSNP
rs1482302315	347	dbSNP
rs866403777	348	dbSNP
rs1277393858	351	dbSNP
rs1007498796	353	dbSNP
rs1347810268	354	dbSNP
rs181623642	358	dbSNP
rs1220487340	361	dbSNP
rs780787093	372	dbSNP
rs1246501519	375	dbSNP
rs934679740	382	dbSNP
rs965817552	384	dbSNP
rs1284466168	387	dbSNP
rs1051766082	397	dbSNP
rs978182376	399	dbSNP
rs923903033	415	dbSNP
rs747751012	416	dbSNP
rs890577347	417	dbSNP
rs1373591201	419	dbSNP
rs1277318988	421	dbSNP
rs1416281835	422	dbSNP
rs1426106508	422	dbSNP
rs958025048	424	dbSNP
rs1471811522	425	dbSNP
rs1254336210	430	dbSNP
rs777813858	431	dbSNP
rs747236220	435	dbSNP
rs1183367305	446	dbSNP
rs989395325	458	dbSNP
rs545677181	459	dbSNP
rs947902178	474	dbSNP
rs1255876054	475	dbSNP
rs1046685111	479	dbSNP
rs1039559954	486	dbSNP
rs1444543530	490	dbSNP
rs1442555713	494	dbSNP
rs373868590	502	dbSNP
rs1241817430	506	dbSNP
rs1330790395	514	dbSNP
rs940416733	519	dbSNP
rs1474461728	520	dbSNP
rs1232490510	525	dbSNP
rs1170582115	529	dbSNP
rs1437300616	532	dbSNP
rs1450280318	538	dbSNP
rs1359883231	541	dbSNP
rs1036079625	543	dbSNP
rs898831320	548	dbSNP
rs186167744	556	dbSNP
rs1160306610	561	dbSNP
rs1475105844	564	dbSNP
rs999730409	572	dbSNP
rs1048626997	576	dbSNP
rs890057888	577	dbSNP
rs1004326439	578	dbSNP
rs1240956870	580	dbSNP
rs1007159500	584	dbSNP
rs1334386339	590	dbSNP
rs1035313410	591	dbSNP
rs755674532	591	dbSNP
rs767652477	591	dbSNP
rs575724180	595	dbSNP
rs1314765814	604	dbSNP
rs1228746595	605	dbSNP
rs991162165	607	dbSNP
rs1299216013	611	dbSNP
rs150042875	614	dbSNP
rs999570142	618	dbSNP
rs1391062357	621	dbSNP
rs1031133177	625	dbSNP
rs978931490	626	dbSNP
rs76065657	630	dbSNP
rs989513275	632	dbSNP
rs934919255	635	dbSNP
rs1419465173	636	dbSNP
rs916485282	646	dbSNP
rs1186089681	651	dbSNP
rs1450846097	655	dbSNP
rs1201447515	659	dbSNP
rs6896077	664	dbSNP
rs1192693368	668	dbSNP
rs555303996	690	dbSNP
rs1190534561	691	dbSNP
rs1266928327	700	dbSNP
rs1222055369	701	dbSNP
rs6894878	702	dbSNP
rs1272437140	716	dbSNP
rs564696987	718	dbSNP
rs1226242736	720	dbSNP
rs1192928977	721	dbSNP
rs1367530890	723	dbSNP
rs1036061288	726	dbSNP
rs1386373866	728	dbSNP
rs1365788140	730	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2013

BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.