| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-3136 |
| Genomic Coordinates | chr3: 69048958 - 69049035 |
| Description | Homo sapiens miR-3136 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-3136-5p | ||||||||||||
| Sequence | 10| CUGACUGAAUAGGUAGGGUCAUU |32 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Illumina | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | PANK1 | ||||||||||||||||||||
| Synonyms | PANK | ||||||||||||||||||||
| Description | pantothenate kinase 1 | ||||||||||||||||||||
| Transcript | NM_138316 | ||||||||||||||||||||
| Other Transcripts | NM_148977 , NM_148978 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on PANK1 | |||||||||||||||||||||
| 3'UTR of PANK1 (miRNA target sites are highlighted) |
>PANK1|NM_138316|3'UTR 1 AGACGAGCAGTGGAGGAAACAGCCTCCCAAAAGGACAGAGAACTAAAAAATTGCTGCTGGAGAAGGTGAAAGTCGCTTTG 81 GGACGGAAGCCAAGCCATTATGGCAGATGAACCTGCTGGATTTGTAAATAATTTAAAATCCTTCCAGATGATCTTTTACT 161 CTTAGGTTTTGAGCTAATGATTCAAAACGGGGGAATATAAAAGGTTTTTTTTCTGTATACTGTATTTTTTTAAAAAAATG 241 GTGCAGCGTGGCCAAACCTACCAATTGTATGCATTAACTTTGAAAAGTTGTTTGATGTTTAAGAAGGACCTGATATGTAA 321 GCGCTGGTCATTTTTCTTCTGGGGTTTACTGATCAGTGTGGTGATTTTAACTTCATTTAGTAATTACTCTAGGAGATTTT 401 ACCTTGACTTATATTTTTCATGACGTTTCATGATTTGCTGTTGGTTTCAAATGAAACTACAAATCTGGCATGTTTTACTG 481 TGAACACTTTTGTTATTTGTTTTGTACCCTTTTTTGTCTTGTTTTTCTGTTTTAGTTGTCTTCTGAAAAAAGAGTCGTTC 561 CCTCTGTTTCTGTCCTCAGATGATGTCCCTCCCCCTACCTGTAACCTTTCTTTGACATAATTGTTCATATCAATGAAGGT 641 GCTGACCAGCTCAATACAAAGTTAAGCACAAGATCTAAAGCTCTTGAAAATGCCCGTGAAGAGAAGACTGAATGTGTTAA 721 TGAATTTAATGAGTCTGGCAAAAGTTGCAAATTATATGCAAGTTTGTCCTATCGCTTATAAATGTAGTGTTTCATTGGAT 801 TTATTTTATGCTAGGTTATATTAAGTTGAAATAGTCTGTGATTAAATGTCCTCATCCATGCACAGAATATGAATGGCAGC 881 AAATCTTTGTGCAAGAAATTTGAAACTTATTGGGAAAAGCCTCCCAGTAGATTAATTGTTCATATCAGGAGATTTAGGGT 961 AAGTCATGGGTTGAGGTGTCAGATAGTAATATCTATTTGTTTTGTACATGTATATATCTAGGAACTTTGTAACAACACAT 1041 CTTTAATAATGTTAAAGGTTTTTTCATTTTTAATATTTTAAACTAAAAACTGTACTTCAATCTCAGTTTCTAAAATTAAA 1121 AATAATTTATACTGATCTATATATTTTTTCTTTTTGAAAGATTTCATTAAGACTGATGGGTAACTTTCAAATGAGGGTCA 1201 TGTACAAATATTGGGATGCATGAGATCCCATGATCTTGTGTATTGAGCTTATTGTTGAAAGGGATTTTTGAAGGACAGAA 1281 CAATTACTCCATGATGAATCTTCCTTTCTCTGCCTTCTGAGCACCGTCTTTAATTTCCATATCTTCAAGTCTTGAAGAAG 1361 TTGATGTTAATTGAAGAATTCACTTGTCTGGTTGAAATAAAGCCTGTTTCTGTTGTGATGTTTTTAGTGTATATGTTATT 1441 TTCATTTCTTAATTCTCATGTTTATAGTATCTGCTTTGTACCATGAAATGACTGTCTGTTGTGTTTTTGCTACTCTACAT 1521 TTCAAAATTGGAGGCTTTCCCATGAGTGTGGTATGGTCCAAAACACTGTCTTCAGGTGAAGCTGTAGCCCTATGCATAGA 1601 TTTTTAAAATAGAGCTTTATTGTTTCTATACAAGTGACTCCTTAATGCCAACTACCTCTGCTATATTTGGTAATTCCAAA 1681 GGAGTTTCAAAATTTGGTCATCACAGATACATTTTACCAACTTCTATCTGGCTTTAAAAAAATTCAGACAGCTAAAGTGT 1761 TCTTGAAAAGGATAAGTTAAAAATCTACATATTATTTATAATTAGTGCCTTTTGATGGCCTCTTCTATTCCTATTCTCAT 1841 CTATCAGGTAACAGCAGACCTTGATTCCGCAGATCATGGTTCTACAAAGGAAATCAGGGCAAGTTAGTGTGACTGTATTT 1921 TTTTTAATTATCTGAAATCACTTGATCTCTCATTACAAACATTTAAAATATTGGTGTAGCTGAGAAAATACATTATTCCA 2001 TTATACAAATATCAGTTAAATGTTGACTACATATAGCCAGCCTGTTTTTTACAAAAGAGATCTTGTAGCCTGAGGATTTT 2081 CACATTCACTTGAATTACAGAAACTTTTCTTAGAATCAACATCACAAAGAAACTGGGAAGACTAAAGAATTTTGACCTTG 2161 TGCAATATGAAGTAAGAGCATGGCTTTTTATCGTGAGGCAGCTTCAGTCTGGGTCCAGCTTAGTCAGTTACCAGTTCAAA 2241 GATATGCTAAGCCTCTTTCTAAACCATAGTTTCCTCACCTATAAAATGGGACAAATAATTGTTTTACATACATATTTAAA 2321 GAGCTCAGCACAGGGGTTGACACAAAGTAAATGCTTCATTAATGATAGCTACAATGAAAAAATAAATTATTTAAACTAAT 2401 TTATTAAATCAGTAATTCTTAACTTTCTGGATTGTGGGAAACCCATGTTAGTATGGAGATGTTTCACCAATCTCCGTATG 2481 CTAATACATATCCACAGCTCCTTGTCCACACTTCCAAAATCCCATACTTAAGAAATCTATCTTGACAGCTCACTTGGCAG 2561 CAAAAGCTGACTTGAGCATTATTTCTCACATGTAGTAGGGCTCTTCACATGTTTTGTTGCAAAGCTCGTCATGAGTTAGA 2641 TAACAGGATACTGACTCTGACAGGGGTGTTAAGTAATAAACGATTTTGAATTGGCTGGGTGTGGTGGCTCACGCCTGTAA 2721 TCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCATGAGGTCAGGAGATCGAGACCATCCTGGCTAATACGGTGAAACCC 2801 CGTCTCTACTGAAAATACAAAAAGCTAGGCATGGTGGTGGGCACCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCGGGAG 2881 AATGGCGTGAACCTGGGAGGCAGAGCTTGCGGTGAGCCGAGATCACACCAATGCACTCCAGCCTGGGAGACAGAGTGAGA 2961 CTGTCTCAAAAAAATAAAATAAATAAATAAATAAATGATTCTGAATTTTGAAACACATCTGATCCCGAGTTTTAGACAAA 3041 GGGATTGTGGAAATATAGTTGTGTTCTTCACCTTATGCAGTATACATGGATTCAGAGTCTCTTTGTTGGGAACAATTGTT 3121 ATAGGTAATGTATACTTGATGTCGTTCAGTCATAGAAGGAATATTAAGAAGTTACTCTGTGCCAGGAAGGAACTGGAGAC 3201 TAAGATGCATAGGATACAGCCCCTGCAGAGAAAGACAGCAAAATCTCAAGCCAACATCAGTCATCAAGTGCCACAAGTGC 3281 CATTCAATCATTTATTCATTCACATTCACAGCAGTAAACAGAACAAAGATCCACCATCACAGAGCTTATATTCTAGAAGG 3361 GAAGACAGGTACATTACTAAATATATAATGTTAGATCAGTACTACAAAGAAAAAGTAAGCTGGTGTAAAGGCTAAATAAG 3441 GGGTAGTTCTATTCAGAAAAATGAGAAGGGGAGGAATATCTCAGGGTGGTCTAAGACAGCCTTTCCTAGGAAGTGACCTT 3521 TGAGCAGAGAGTTGAATGGAGGTGAGAACACATTGTGTAAATGTCTGAGAAAATATTTTTCACTCCTGGCAAATGAAAAT 3601 AGGGATTTGAGGAACTGCAAAGAGGCCAGTGTCTGGAGTTAAAAATAGAAAGTGGTGGGAGATGCAGTGTTGGGAGTAAA 3681 CTTGAGCCAGGTCCTATAAGAAATCTGTGAGGGTAGTGGCCTCTACCCAGAAGAGAGGTTGGTCATTTGTCTTCCAGAAG 3761 GTGCTAGAGAAGGTTTTGTGAAGTCTTAACCAAAGAATAGGAATCACTAAGTGGAGAGGAAGGGAGGGCTTTCCAAGCAG 3841 AGGGAGCTGGGTGAGCAGAAGCGCTGAGGGAAGAAACCACTTGGCTTATTCAGGGACTGGAAGCTCTTTGCTATAGCTGG 3921 AGCCTGGTTCATGAGACAGAAACCAGGTAGTGAGAAAGAGGAAGCTGGCCCAACTGTGGAAGGACTTGTCTTCCATGCTA 4001 ACATTGCGGACTTTTCCGTAGTCACTGTGGAGCCATCAAAGAGTTTCAAGGAAAGTGAAACTAGAAATAATCAGGTTTCA 4081 AAGTGGTAAAGCAAAATGCTCTGTTGAAGTAAATGAGTAAACAAGTTACGTACTTTTGAATACCTAACATTATTCCATTT 4161 TTTTCCCTATTGTGCCAGACCTCATGCAGTAGCTACAGAGTGAACCATGCTTTCGCTGTAAGTAGGATGGCTATAAAAAT 4241 TATTGAGAACTTTCTCAGAGGACACAGGCTACTAATAGCTACAGCCCCACTATGAGTCTATTCATTGAGCAAGAAGGTTT 4321 CAATACTGGGAGCATCGTAAACTATCACTCACAAGAATTGTTAGAAAGCAGTTTTCCTCCCAGTGATCAGAAGATGACGC 4401 CACATTTGTGAAAAAGATTTCATTAGTGTACATCGTTTATTAGGTCTACCAGCTGCCCATTCTTTTGCTCATCTGTTTAA 4481 TTTTTAATAAATATCAATGATCTGAGAGGCATTGGGTAGCACTGAGGATGCAATCCGATGTGAACAAGACTTCAGGAGCT 4561 CTGCTTTCATTAGGCTTACATTTGGTTAATGGAGATAAACTTGAAGCATATAAACCAATAAATAAACAAGAAAATATCAG 4641 GGAGTGACAATTGCTATTAAGGAAAGAAACAGGGTGATAGGATAGAGAGGGAGGAGAGAGACTTCTTCAGTCAGATGATC 4721 ATAAAATGCAAGTATGATTAAGTCATGGCCTCAACTTTTAAGGAATGATGGGCTCACCTTGCTTTCATTCTTGCCACCTC 4801 CTCAATGAAAATGAAAGATGTTTTTGGGAAACTGATAGCTAATTTTCTTTTTCTTAGAATATTTGATTTAGATAATATGT 4881 ATTTAAAATAAAGTTATCACGTAAAATAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 53354.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 53354.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 , TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293S |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
| Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
| CLIP-seq Support 1 for dataset GSM1084064 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
| Location of target site | ENST00000322191.6 | 3UTR | GAUAGGAUAGAGAGGGAGGAGAGAGACUUCUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000322191.6 | 3UTR | UUCUUCAGUCAGAUGAUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545213 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000322191.6 | 3UTR | UUCUUCAGUCAGAUGAUCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000322191.6 | 3UTR | CUUCUUCAGUCAGAUGAUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000322191.6 | 3UTR | UUCUUCAGUCAGAUGAUCAUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000322191.6 | 3UTR | AGACUUCUUCAGUCAGAUGAUCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1462573 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl BaL |
| Location of target site | ENST00000322191.6 | 3UTR | AGACUUCUUCAGUCAGAUGAUCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
84 hsa-miR-3136-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT081899 | KCTD15 | potassium channel tetramerization domain containing 15 |  |
|
2 | 2 | ||||||
| MIRT185493 | SRP9 | signal recognition particle 9 | |
|
2 | 2 | ||||||
| MIRT207226 | TET3 | tet methylcytosine dioxygenase 3 | |
|
2 | 2 | ||||||
| MIRT246179 | TXNIP | thioredoxin interacting protein | |
|
2 | 4 | ||||||
| MIRT347685 | LSM14A | LSM14A, mRNA processing body assembly factor | |
|
2 | 2 | ||||||
| MIRT444157 | ZNF701 | zinc finger protein 701 | |
|
2 | 2 | ||||||
| MIRT444505 | ZNF525 | zinc finger protein 525 | |
|
2 | 2 | ||||||
| MIRT444683 | NDOR1 | NADPH dependent diflavin oxidoreductase 1 | |
|
2 | 2 | ||||||
| MIRT445131 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | |
|
2 | 2 | ||||||
| MIRT446184 | FGF1 | fibroblast growth factor 1 | |
|
2 | 2 | ||||||
| MIRT447946 | AKR7A2 | aldo-keto reductase family 7 member A2 | |
|
2 | 2 | ||||||
| MIRT449366 | ANTXR2 | anthrax toxin receptor 2 | |
|
2 | 2 | ||||||
| MIRT449774 | SULF2 | sulfatase 2 | |
|
2 | 2 | ||||||
| MIRT450096 | ST8SIA5 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT450903 | CADM2 | cell adhesion molecule 2 | |
|
2 | 4 | ||||||
| MIRT455645 | YARS | tyrosyl-tRNA synthetase | |
|
2 | 2 | ||||||
| MIRT465135 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT476177 | GOLGA8A | golgin A8 family member A | |
|
2 | 8 | ||||||
| MIRT483978 | PANK1 | pantothenate kinase 1 | |
|
2 | 10 | ||||||
| MIRT497016 | INO80B | INO80 complex subunit B | |
|
2 | 2 | ||||||
| MIRT497450 | DDR2 | discoidin domain receptor tyrosine kinase 2 | |
|
2 | 2 | ||||||
| MIRT497626 | ZNF576 | zinc finger protein 576 | |
|
2 | 2 | ||||||
| MIRT498187 | AKR1B10 | aldo-keto reductase family 1 member B10 | |
|
2 | 2 | ||||||
| MIRT504036 | TOMM5 | translocase of outer mitochondrial membrane 5 | |
|
2 | 2 | ||||||
| MIRT507106 | GOLGA8B | golgin A8 family member B | |
|
2 | 4 | ||||||
| MIRT507900 | CALM2 | calmodulin 2 | |
|
2 | 6 | ||||||
| MIRT508802 | MTPN | myotrophin | |
|
2 | 6 | ||||||
| MIRT510407 | ZNF268 | zinc finger protein 268 | |
|
2 | 4 | ||||||
| MIRT516297 | F8A2 | coagulation factor VIII associated 2 | |
|
2 | 2 | ||||||
| MIRT516323 | F8A3 | coagulation factor VIII associated 3 | |
|
2 | 2 | ||||||
| MIRT528028 | FEZ2 | fasciculation and elongation protein zeta 2 | |
|
2 | 2 | ||||||
| MIRT529396 | ICK | intestinal cell kinase | |
|
2 | 2 | ||||||
| MIRT534463 | SCD | stearoyl-CoA desaturase | |
|
2 | 4 | ||||||
| MIRT535438 | PDE4D | phosphodiesterase 4D | |
|
2 | 2 | ||||||
| MIRT538187 | DBN1 | drebrin 1 | |
|
2 | 2 | ||||||
| MIRT547386 | MOB1A | MOB kinase activator 1A | |
|
2 | 2 | ||||||
| MIRT548180 | FOXC1 | forkhead box C1 | |
|
2 | 2 | ||||||
| MIRT561585 | SKI | SKI proto-oncogene | |
|
2 | 2 | ||||||
| MIRT569449 | PIGP | phosphatidylinositol glycan anchor biosynthesis class P | |
|
2 | 2 | ||||||
| MIRT573314 | RFC5 | replication factor C subunit 5 | |
|
2 | 2 | ||||||
| MIRT574762 | FLVCR1 | feline leukemia virus subgroup C cellular receptor 1 | |
|
2 | 2 | ||||||
| MIRT575975 | Fem1a | feminization 1 homolog a (C. elegans) | |
|
2 | 5 | ||||||
| MIRT575999 | Zfp106 | zinc finger protein 106 | |
1 | 1 | |||||||
| MIRT576277 | Cd59a | CD59a antigen | |
1 | 1 | |||||||
| MIRT606772 | KIAA0040 | KIAA0040 | |
|
2 | 5 | ||||||
| MIRT606833 | FEM1A | fem-1 homolog A | |
|
2 | 7 | ||||||
| MIRT608302 | MCM8 | minichromosome maintenance 8 homologous recombination repair factor | |
|
2 | 2 | ||||||
| MIRT609269 | MAPKAPK5 | mitogen-activated protein kinase-activated protein kinase 5 | |
|
2 | 2 | ||||||
| MIRT609405 | SLC25A45 | solute carrier family 25 member 45 | |
|
2 | 2 | ||||||
| MIRT609603 | TRPC4AP | transient receptor potential cation channel subfamily C member 4 associated protein | |
|
2 | 2 | ||||||
| MIRT610105 | IL17REL | interleukin 17 receptor E like | |
|
2 | 3 | ||||||
| MIRT610327 | SSX5 | SSX family member 5 | |
|
2 | 2 | ||||||
| MIRT610610 | ARHGAP18 | Rho GTPase activating protein 18 | |
|
2 | 2 | ||||||
| MIRT611066 | ZNF621 | zinc finger protein 621 | |
|
2 | 2 | ||||||
| MIRT611492 | ZNF440 | zinc finger protein 440 | |
|
2 | 2 | ||||||
| MIRT611931 | ZNF106 | zinc finger protein 106 | |
|
2 | 3 | ||||||
| MIRT612239 | MICALL1 | MICAL like 1 | |
|
2 | 2 | ||||||
| MIRT612451 | SMOC1 | SPARC related modular calcium binding 1 | |
|
2 | 4 | ||||||
| MIRT612567 | RBBP5 | RB binding protein 5, histone lysine methyltransferase complex subunit | |
|
2 | 2 | ||||||
| MIRT613111 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | |
|
2 | 2 | ||||||
| MIRT614946 | KAT6B | lysine acetyltransferase 6B | |
|
2 | 2 | ||||||
| MIRT615100 | BNC2 | basonuclin 2 | |
|
2 | 2 | ||||||
| MIRT616424 | FAM126B | family with sequence similarity 126 member B | |
|
2 | 2 | ||||||
| MIRT617839 | FMO4 | flavin containing monooxygenase 4 | |
|
2 | 2 | ||||||
| MIRT618499 | HSPD1 | heat shock protein family D (Hsp60) member 1 | |
|
2 | 2 | ||||||
| MIRT619230 | FBXL4 | F-box and leucine rich repeat protein 4 | |
|
2 | 2 | ||||||
| MIRT624202 | DCP2 | decapping mRNA 2 | |
|
2 | 4 | ||||||
| MIRT630405 | MTX3 | metaxin 3 | |
|
2 | 2 | ||||||
| MIRT640327 | DAAM2 | dishevelled associated activator of morphogenesis 2 | |
|
2 | 2 | ||||||
| MIRT642779 | CHCHD3 | coiled-coil-helix-coiled-coil-helix domain containing 3 | |
|
2 | 2 | ||||||
| MIRT654363 | RBM23 | RNA binding motif protein 23 | |
|
2 | 2 | ||||||
| MIRT654482 | RANBP2 | RAN binding protein 2 | |
|
2 | 2 | ||||||
| MIRT656336 | MED28 | mediator complex subunit 28 | |
|
2 | 2 | ||||||
| MIRT662856 | UPF3A | UPF3A, regulator of nonsense mediated mRNA decay | |
|
2 | 2 | ||||||
| MIRT666894 | POLA2 | DNA polymerase alpha 2, accessory subunit | |
|
2 | 2 | ||||||
| MIRT669526 | AP5M1 | adaptor related protein complex 5 mu 1 subunit | |
|
2 | 2 | ||||||
| MIRT671561 | IL2RA | interleukin 2 receptor subunit alpha | |
|
2 | 2 | ||||||
| MIRT707042 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | |
|
2 | 2 | ||||||
| MIRT717063 | MTMR6 | myotubularin related protein 6 | |
|
2 | 2 | ||||||
| MIRT717223 | SH2D5 | SH2 domain containing 5 | |
|
2 | 2 | ||||||
| MIRT719867 | CYP4F11 | cytochrome P450 family 4 subfamily F member 11 | |
|
2 | 2 | ||||||
| MIRT719967 | RBX1 | ring-box 1 | |
|
2 | 2 | ||||||
| MIRT723594 | FKRP | fukutin related protein | |
|
2 | 2 | ||||||
| MIRT725081 | VCPIP1 | valosin containing protein interacting protein 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|