>AIP|NM_003977|3'UTR
   1 CAGGAGCACTTGGCCCTGCCTTACCTGCCAAGCCCACTGCTGCAGCTGCCAGCCCCCCTGCCCGTGCTGCGTCATGCTTC
  81 TGTGTATATAAAGGCCTTTATTTATCTCTCTCTGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gugGGGGUGG-UGGUGCGGGc 5' ||::||| :||| |||| Target 5' ctgCCTTACCTGCCAAGCCCa 3'	16 - 36	133.00	-22.00
2	miRNA 3' guGGGGGU-GGUGGUGCGGGc 5' |: ||| || || :|||| Target 5' agCTGCCAGCCCCCCTGCCCg 3'	44 - 64	114.00	-24.30
3	miRNA 3' guGGGGGUG--GUGGUGCGGGC---- 5' ||| ::| |::||:||:: Target 5' tgCCCGTGCTGCGTCATGCTTCTGTG 3'	59 - 84	94.00	-15.00

Mutant ID	Mutant Position	Mutant Source
305735	61	ClinVar
305736	65	ClinVar

Mutant ID	Mutant Position	Mutant Source
rs753775736	3	dbSNP
rs1480272833	5	dbSNP
rs1162928896	14	dbSNP
rs1171405054	14	dbSNP
rs142567224	15	dbSNP
rs1460549175	16	dbSNP
rs777609189	17	dbSNP
rs1366787086	18	dbSNP
rs1407131755	20	dbSNP
rs1405928753	21	dbSNP
rs1301752994	24	dbSNP
rs1345276828	25	dbSNP
rs1382379278	28	dbSNP
rs746893096	31	dbSNP
rs942281164	34	dbSNP
rs1037052035	37	dbSNP
rs757211910	41	dbSNP
rs1287302383	45	dbSNP
rs780071736	47	dbSNP
rs959182919	50	dbSNP
rs1292384808	53	dbSNP
rs896802921	54	dbSNP
rs1289753028	57	dbSNP
rs983949796	58	dbSNP
rs1299178939	59	dbSNP
rs146014363	61	dbSNP
rs562462428	64	dbSNP
rs115346238	65	dbSNP
rs868173257	71	dbSNP
rs548569469	72	dbSNP
rs778583953	78	dbSNP
rs774778133	83	dbSNP
rs762342615	88	dbSNP
rs967907123	89	dbSNP
rs943503080	94	dbSNP
rs1031359760	103	dbSNP
rs1053997327	105	dbSNP
rs1418667037	105	dbSNP
rs1191769625	107	dbSNP
rs893978608	109	dbSNP
rs1471851183	111	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.