pre-miRNA Information
pre-miRNA hsa-mir-4291   
Genomic Coordinates chr9: 93819357 - 93819421
Description Homo sapiens miR-4291 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4291
Sequence 11| UUCAGCAGGAACAGCU |26
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1265713434 9 dbSNP
rs1433969451 12 dbSNP
rs1372852268 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UBE2V1   
Synonyms CIR1, CROC-1, CROC1, UBE2V, UEV-1, UEV1, UEV1A
Description ubiquitin conjugating enzyme E2 V1
Transcript NM_001032288   
Other Transcripts NM_021988 , NM_022442 , NM_199144   
Expression
Putative miRNA Targets on UBE2V1
3'UTR of UBE2V1
(miRNA target sites are highlighted)
>UBE2V1|NM_001032288|3'UTR
   1 TCAAAAAGAAAAACCACAGGCCCTTCCCCTTCCCCCCAATTCGATTTAATCAGTCTTCATTTTCCACAGTAGTAAATTTT
  81 CTAGATACGTCTTGTAGACCTCAAAGTACCGGAAAGGAAGCTCCCATTCAAAGGAAATTTATCTTAAGATACTGTAAATG
 161 ATACTAATTTTTTGTCCATTTGAAATATATAAGTTGTGCTATAACAAATCATCCTGTCAAGTGTAACCACTGTCCACGTA
 241 GTTGAACTTCTGGGATCAAGAAAGTCTATTTAAATTGATTCCCATCATAACTGGTGGGGCACATCTAACTCAACTGTGAA
 321 AAGACACATCACACAATCACCTTGCTGCTGATTACACGGCCTGGGGTCTCTGCCTTCTCCCCTTACCCTCCCGCCTCCCA
 401 CCCTCCCTGCAACAACAGCCCTCTAGCCTGGGGGGCTTGTTAGAGTAGATGTGAAGGTTTCAGGTCGCAGCCTGTGGGAC
 481 TACTGCTAGGTGTGTGGGGTGTTTCGCCTGCACCCCTGGTTTCTTTAAGTCTTAAGTGATGCCCCTTCCAAACCATCATC
 561 CTGTCCCCACGCTCCTCCACTCCCGCCCTTGGCCGAAGCATAGATTGTAACCCCTCCACTCCCCTCTGAGATTGGCCTTC
 641 GGTGAGGAATTCAGGGCTTTCCCCATATCTTCTCTCCCCCACCTTTATCGAGGGGTGCTGCTTTTTCTCCCTCCTCCTCA
 721 AGTTCCTTTTTGCACCGTCACCACCCAACACCTTCCATGACACTTCCTTGCTTTGGCCAGAAGCCATCAGGTAAGGTTGG
 801 AAAGAGCCTCTGACCTCCCTTGTTTAGTTTTGGAACCATACTCACTCACTCTCCACCAGCCTGGGAAATGAATATTGGGT
 881 CCTCAGCCCTGCCACCCTCTGCTGTCATCAGCTGATGCATTGTTTTTAGCTCAGGTTTTGATAAGGTGAAAAGAATAGTC
 961 ACCAGGGTTACTCAGACCTGCCAGCTCTCGGAGTCCTTGGTGGTTGAACTTGGAGAAAGACCGCATGAAGATACTTGTAA
1041 GCACACATGATCCCTCTGAATTGTTTTACTTTCCTGTAACTGCTTTTGCTTTTAAAAATTGAAGAAGTTTTAAACAGGGC
1121 TTTCATTTGGTCATCCTTGCAATCCATTGGGGTCTAGTTTGGAATCTGACAACTGGAACAAAAAGAACCTTGAATCCGGT
1201 GCATGCCTTGGTTTTGGTGCTGCTGCTGCTTCCCAAGATCCTCAGCAGGGATTAAGAAGGAACCCGGTGTGCACAGCAGA
1281 TCCCCGAAATTGGTGGGCTTGACCTCCTGGCAAATTGCTGCGTCTTTCCACTTGCTGTTCAGGACCACTAAATGCTGAAA
1361 TGTGGATGCATACCGAAATAAAAGCAATTCATTGTGTACTAAAGGTTTTTTTTTTTTTTTTAATTTAGTATTTGTGTAAA
1441 ACCACCTTTTGAAGCAGCAACTATCAAGTCTGAAAAGCAATTGATGTTTCCATTAATCTTTTTCTGGGGGGAAAACCTTA
1521 GTTCTAAGGATTTAACATCCTGTAAGTGAAGTTTAACATAACAGTATTCCATAAGCAGCCTTTTTATTGTCAGACCATTG
1601 CCTGATTTTAATATAATAAAAAAAAAGTGTGCGTTAATATTTAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucgacAAGGACGACUu 5'
               || ||||||| 
Target 5' tcaccTTGCTGCTGAt 3'
337 - 352 147.00 -9.90
2
miRNA  3' ucGACAAGGACGACuu 5'
            :|| | ||||||  
Target 5' ttTTGGTGCTGCTGct 3'
1212 - 1227 130.00 -9.70
3
miRNA  3' ucgacaaGGACGACuu 5'
                 :||||||  
Target 5' gccacccTCTGCTGtc 3'
891 - 906 121.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24307096 3 COSMIC
COSN26998937 22 COSMIC
COSN30476187 28 COSMIC
COSN30505513 31 COSMIC
COSN30458627 32 COSMIC
COSN30458620 33 COSMIC
COSN30169210 52 COSMIC
COSN31567363 75 COSMIC
COSN13867558 88 COSMIC
COSN26998936 89 COSMIC
COSN30144721 107 COSMIC
COSN30502742 112 COSMIC
COSN30184289 115 COSMIC
COSN31559335 244 COSMIC
COSN28824255 287 COSMIC
COSN26563719 360 COSMIC
COSN28677500 382 COSMIC
COSN26325394 427 COSMIC
COSN22596479 456 COSMIC
COSN31579035 497 COSMIC
COSN31519043 505 COSMIC
COSN31512891 513 COSMIC
COSN28648771 522 COSMIC
COSN8000421 570 COSMIC
COSN26665932 737 COSMIC
COSN26665931 752 COSMIC
COSN21694650 755 COSMIC
COSN26646230 761 COSMIC
COSN31608558 764 COSMIC
COSN26665930 788 COSMIC
COSN9141735 827 COSMIC
COSN26644422 881 COSMIC
COSN26637891 882 COSMIC
COSN31585404 906 COSMIC
COSN26580109 945 COSMIC
COSN31484609 1058 COSMIC
COSN8899531 1144 COSMIC
COSN30176705 1286 COSMIC
COSN28402157 1322 COSMIC
COSN26548224 1348 COSMIC
COSN31596053 1392 COSMIC
COSN31529740 1404 COSMIC
COSN19660945 1406 COSMIC
COSN31518694 1441 COSMIC
COSN31529170 1498 COSMIC
COSN23222315 1617 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1327160254 7 dbSNP
rs750111448 8 dbSNP
rs765043055 13 dbSNP
rs761226884 15 dbSNP
rs1472196388 16 dbSNP
rs1363988460 18 dbSNP
rs1183602229 20 dbSNP
rs200602780 21 dbSNP
rs528812995 23 dbSNP
rs1214104193 26 dbSNP
rs1469722543 27 dbSNP
rs760688909 28 dbSNP
rs201295239 29 dbSNP
rs187204768 32 dbSNP
rs1262699317 33 dbSNP
rs773415961 35 dbSNP
rs1194254182 36 dbSNP
rs779631764 36 dbSNP
rs1376444799 38 dbSNP
rs371693730 39 dbSNP
rs899700274 40 dbSNP
rs748150641 42 dbSNP
rs368141343 43 dbSNP
rs1005431935 56 dbSNP
rs780048962 58 dbSNP
rs1351757693 61 dbSNP
rs182869336 71 dbSNP
rs557493991 88 dbSNP
rs1369437294 89 dbSNP
rs1242899650 93 dbSNP
rs73611765 104 dbSNP
rs73611764 110 dbSNP
rs1366614450 111 dbSNP
rs1270503795 112 dbSNP
rs1432674901 115 dbSNP
rs1343596496 121 dbSNP
rs1049065708 124 dbSNP
rs1448546963 130 dbSNP
rs929329105 135 dbSNP
rs897810106 139 dbSNP
rs1056989975 144 dbSNP
rs527244006 152 dbSNP
rs939444041 153 dbSNP
rs1416251387 170 dbSNP
rs544387060 172 dbSNP
rs1377397162 175 dbSNP
rs577095993 180 dbSNP
rs1172293414 189 dbSNP
rs148757188 198 dbSNP
rs191054982 208 dbSNP
rs1449714514 210 dbSNP
rs1330103976 214 dbSNP
rs41283596 215 dbSNP
rs1474636788 229 dbSNP
rs73611763 237 dbSNP
rs946969330 238 dbSNP
rs915467088 253 dbSNP
rs1272049911 261 dbSNP
rs1331994721 265 dbSNP
rs1200527091 266 dbSNP
rs988379194 268 dbSNP
rs1437104695 280 dbSNP
rs1179400646 283 dbSNP
rs554507531 288 dbSNP
rs1029326485 303 dbSNP
rs976940985 314 dbSNP
rs1467243302 315 dbSNP
rs1169053770 319 dbSNP
rs1396425563 338 dbSNP
rs1485693876 341 dbSNP
rs1408641796 355 dbSNP
rs963794287 357 dbSNP
rs1356483318 358 dbSNP
rs1018084315 361 dbSNP
rs1292292850 365 dbSNP
rs1353088599 367 dbSNP
rs1219950926 368 dbSNP
rs1251317536 378 dbSNP
rs8585 382 dbSNP
rs1193955471 383 dbSNP
rs775806445 384 dbSNP
rs1485858324 389 dbSNP
rs1025541554 392 dbSNP
rs1255651312 396 dbSNP
rs1478890544 396 dbSNP
rs1216093844 401 dbSNP
rs1372533106 406 dbSNP
rs144341721 413 dbSNP
rs1447090241 418 dbSNP
rs1277771319 420 dbSNP
rs1174801340 426 dbSNP
rs1376519226 430 dbSNP
rs897855587 443 dbSNP
rs1311381438 445 dbSNP
rs73611762 458 dbSNP
rs149631469 466 dbSNP
rs1383519690 467 dbSNP
rs879941567 478 dbSNP
rs1311098113 479 dbSNP
rs1225201538 482 dbSNP
rs1056436022 483 dbSNP
rs1305530392 490 dbSNP
rs1348394533 494 dbSNP
rs1209902067 498 dbSNP
rs1465608196 505 dbSNP
rs747116362 506 dbSNP
rs1205887038 512 dbSNP
rs905254358 513 dbSNP
rs1426811509 514 dbSNP
rs1045270254 517 dbSNP
rs1049679 522 dbSNP
rs1454169890 523 dbSNP
rs915393538 532 dbSNP
rs1053153792 533 dbSNP
rs73611761 536 dbSNP
rs1455069553 538 dbSNP
rs935587429 545 dbSNP
rs759598047 548 dbSNP
rs1383697942 549 dbSNP
rs922267379 550 dbSNP
rs73611760 552 dbSNP
rs1327261702 567 dbSNP
rs976404142 568 dbSNP
rs964150271 570 dbSNP
rs73611759 571 dbSNP
rs1259221627 582 dbSNP
rs1185068827 584 dbSNP
rs774173278 585 dbSNP
rs1260353908 592 dbSNP
rs1482676227 595 dbSNP
rs1211720825 599 dbSNP
rs1233380662 613 dbSNP
rs1253661334 619 dbSNP
rs73611758 622 dbSNP
rs1468447440 624 dbSNP
rs1192284516 632 dbSNP
rs1240455774 633 dbSNP
rs73611757 640 dbSNP
rs1305526283 641 dbSNP
rs752721921 651 dbSNP
rs73611756 655 dbSNP
rs1166502575 662 dbSNP
rs1394510605 664 dbSNP
rs1440138786 665 dbSNP
rs868658306 674 dbSNP
rs6095755 676 dbSNP
rs1375335838 677 dbSNP
rs1391777014 678 dbSNP
rs1025425012 680 dbSNP
rs1235316253 681 dbSNP
rs1337135154 683 dbSNP
rs994499953 689 dbSNP
rs1212438777 690 dbSNP
rs959945210 694 dbSNP
rs1481212921 695 dbSNP
rs80158980 707 dbSNP
rs1176991228 716 dbSNP
rs1374234484 717 dbSNP
rs1189594783 720 dbSNP
rs770370283 720 dbSNP
rs1003516625 725 dbSNP
rs1440716704 726 dbSNP
rs528773295 733 dbSNP
rs73611755 737 dbSNP
rs754594279 740 dbSNP
rs114097793 742 dbSNP
rs894010518 746 dbSNP
rs1162340301 755 dbSNP
rs1370882745 759 dbSNP
rs73611754 761 dbSNP
rs181019888 762 dbSNP
rs1294129970 768 dbSNP
rs1408137007 770 dbSNP
rs59124899 782 dbSNP
rs73611753 784 dbSNP
rs1231543169 786 dbSNP
rs1275125492 791 dbSNP
rs1308627808 793 dbSNP
rs1204375556 796 dbSNP
rs1250024552 804 dbSNP
rs1456351686 814 dbSNP
rs1237495207 815 dbSNP
rs1486838574 816 dbSNP
rs1214022611 818 dbSNP
rs1257803242 820 dbSNP
rs935583318 830 dbSNP
rs1271508513 837 dbSNP
rs1244392235 841 dbSNP
rs1317572762 849 dbSNP
rs374126556 852 dbSNP
rs545495098 853 dbSNP
rs1169620042 856 dbSNP
rs1352615743 859 dbSNP
rs1436338365 859 dbSNP
rs1313200964 861 dbSNP
rs1375075469 863 dbSNP
rs751129605 864 dbSNP
rs1413119490 874 dbSNP
rs1272020927 875 dbSNP
rs1041683241 878 dbSNP
rs578177787 886 dbSNP
rs1376727045 888 dbSNP
rs777590807 892 dbSNP
rs558706247 895 dbSNP
rs942395810 897 dbSNP
rs1280016716 904 dbSNP
rs1392791136 909 dbSNP
rs1361971820 912 dbSNP
rs1243387885 918 dbSNP
rs1485907657 920 dbSNP
rs1185916313 925 dbSNP
rs1388262194 926 dbSNP
rs1455480410 928 dbSNP
rs1174063318 940 dbSNP
rs1394193833 946 dbSNP
rs910887394 954 dbSNP
rs1320495288 955 dbSNP
rs1345930033 957 dbSNP
rs1430124432 962 dbSNP
rs1287125744 968 dbSNP
rs983869694 971 dbSNP
rs1291407801 973 dbSNP
rs1303193371 981 dbSNP
rs1346130710 983 dbSNP
rs1457052224 986 dbSNP
rs952432084 989 dbSNP
rs73611752 990 dbSNP
rs755701683 996 dbSNP
rs1317077628 1012 dbSNP
rs879458095 1019 dbSNP
rs1469784005 1021 dbSNP
rs1437288446 1022 dbSNP
rs540060498 1023 dbSNP
rs1160571546 1025 dbSNP
rs573044579 1033 dbSNP
rs1408994300 1041 dbSNP
rs1400303487 1044 dbSNP
rs1157068231 1047 dbSNP
rs1396766423 1056 dbSNP
rs1442334469 1063 dbSNP
rs1325821177 1068 dbSNP
rs1369319531 1073 dbSNP
rs190672140 1074 dbSNP
rs1444828879 1076 dbSNP
rs1280434152 1082 dbSNP
rs1373645674 1091 dbSNP
rs972570791 1099 dbSNP
rs1194262082 1117 dbSNP
rs765923024 1130 dbSNP
rs1265745096 1133 dbSNP
rs1455399165 1136 dbSNP
rs762699970 1141 dbSNP
rs1265068992 1146 dbSNP
rs1209049303 1147 dbSNP
rs535813598 1151 dbSNP
rs1233198266 1158 dbSNP
rs960241899 1164 dbSNP
rs1180249701 1188 dbSNP
rs568498428 1197 dbSNP
rs1486294844 1198 dbSNP
rs1164232469 1203 dbSNP
rs556570713 1205 dbSNP
rs1412091779 1207 dbSNP
rs1262719681 1210 dbSNP
rs1329996253 1217 dbSNP
rs980407866 1220 dbSNP
rs1213660633 1225 dbSNP
rs1353150640 1227 dbSNP
rs2733 1233 dbSNP
rs1233380045 1238 dbSNP
rs1292094517 1241 dbSNP
rs535738819 1244 dbSNP
rs1369457027 1245 dbSNP
rs1011001131 1265 dbSNP
rs765686922 1266 dbSNP
rs1031603733 1267 dbSNP
rs1203354214 1273 dbSNP
rs15218 1282 dbSNP
rs115164526 1285 dbSNP
rs1290320039 1286 dbSNP
rs1475619019 1289 dbSNP
rs901321066 1293 dbSNP
rs73611751 1295 dbSNP
rs1476701953 1299 dbSNP
rs1168962884 1306 dbSNP
rs368384878 1309 dbSNP
rs186621934 1313 dbSNP
rs1376935527 1315 dbSNP
rs762056905 1317 dbSNP
rs1436456382 1320 dbSNP
rs1332988963 1321 dbSNP
rs777176288 1322 dbSNP
rs942949266 1323 dbSNP
rs1270685435 1324 dbSNP
rs1363373433 1335 dbSNP
rs374324590 1337 dbSNP
rs1428912944 1341 dbSNP
rs1225910254 1354 dbSNP
rs1282143095 1355 dbSNP
rs1486133858 1362 dbSNP
rs1210412389 1366 dbSNP
rs1254217844 1375 dbSNP
rs889457438 1375 dbSNP
rs1191826713 1381 dbSNP
rs1487990461 1385 dbSNP
rs1373022045 1398 dbSNP
rs1448129799 1401 dbSNP
rs1281066370 1405 dbSNP
rs1213149742 1406 dbSNP
rs35338409 1406 dbSNP
rs1343402798 1408 dbSNP
rs1255931478 1409 dbSNP
rs1399513469 1410 dbSNP
rs1048011735 1411 dbSNP
rs931083930 1412 dbSNP
rs201099481 1421 dbSNP
rs1271986371 1422 dbSNP
rs1353042650 1422 dbSNP
rs1432746752 1422 dbSNP
rs566510389 1422 dbSNP
rs74435910 1422 dbSNP
rs878876092 1422 dbSNP
rs1328625645 1423 dbSNP
rs1205794427 1424 dbSNP
rs972879830 1424 dbSNP
rs1297242339 1427 dbSNP
rs752330982 1427 dbSNP
rs1397809291 1428 dbSNP
rs1339472928 1430 dbSNP
rs1174333184 1434 dbSNP
rs1312916426 1434 dbSNP
rs1375579599 1442 dbSNP
rs2664563 1444 dbSNP
rs1454988695 1452 dbSNP
rs938551200 1460 dbSNP
rs1387243547 1463 dbSNP
rs1455608963 1484 dbSNP
rs1327830454 1490 dbSNP
rs1371532175 1495 dbSNP
rs1386020825 1504 dbSNP
rs1298832061 1509 dbSNP
rs1240003244 1512 dbSNP
rs1337784130 1512 dbSNP
rs1049871 1514 dbSNP
rs1327157604 1518 dbSNP
rs1216160245 1521 dbSNP
rs2664532 1524 dbSNP
rs1274370806 1536 dbSNP
rs1208925504 1542 dbSNP
rs1189876483 1543 dbSNP
rs1253044829 1555 dbSNP
rs1420551660 1557 dbSNP
rs1171986317 1558 dbSNP
rs1182039828 1561 dbSNP
rs1462301497 1567 dbSNP
rs980050190 1569 dbSNP
rs1395129720 1571 dbSNP
rs1457306679 1576 dbSNP
rs1291620766 1579 dbSNP
rs1398328634 1584 dbSNP
rs761101085 1590 dbSNP
rs969926367 1594 dbSNP
rs1374631996 1600 dbSNP
rs1168298684 1612 dbSNP
rs567922169 1613 dbSNP
rs1258489626 1614 dbSNP
rs989456149 1616 dbSNP
rs1190084659 1617 dbSNP
rs1235224359 1618 dbSNP
rs1293945527 1626 dbSNP
rs10567504 1627 dbSNP
rs1219973741 1627 dbSNP
rs1253488306 1627 dbSNP
rs1322759081 1629 dbSNP
rs1481160284 1630 dbSNP
rs1205497350 1632 dbSNP
rs201015788 1632 dbSNP
rs1044975480 1633 dbSNP
rs1189482605 1637 dbSNP
rs775575773 1639 dbSNP
rs754458946 1645 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucgacAAGGACGACuu 5'
               || ||||||  
Target 5' ucaccUUGCUGCUG-- 3'
14 - 27
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7335.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7335.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_001032288 | 3UTR | AACUGUGAAAAGACACAUCACACAAUCACCUUGCUGCUGAUUACACGGCCUGGGGUCUCUGCCUUCUCCCCUUACCCUCCCGCCUCCCACCCUCCCUGCAACAACAGCCCUCUAGCCUGGGGGGCUUGUUAGAGUAGAUGUGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001032288 | 3UTR | ACGUAGUUGAACUUCUGGGAUCAAGAAAGUCUAUUUAAAUUGAUUCCCAUCAUAACUGGUGGGGCACAUCUAACUCAACUGUGAAAAGACACAUCACACAAUCACCUUGCUGCUGAUUACACGGCCUGGGGUCUCUGCCUUCUCCCCUUACCCUCCCGCCUCCCACCCUCCCUGCAACAACAGCCCUCUAGCCUGGGGGGCUUGUUAGAGUAGAUGUGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_199144 | 3UTR | CUCCUGGCAAAUUGCUGCGUCUUUCCACUUGCUGUUCAGGACCACUAAAUGCUGAAAUGUGGAUGCAUACCGAAAUAAAAGCAAUUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001032288 | 3UTR | CAGAUCCCCGAAAUUGGUGGGCUUGACCUCCUGGCAAAUUGCUGCGUCUUUCCACUUGCUGUUCAGGACCACUAAAUGCUGAAAUGUGGAUGCAUACCGAAAUAAAAGCAAUUCAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001032288 | 3UTR | UUCCACUUGCUGUUCAGGACCACUAAAUGCUGAAAUGUGGAUGCAUACCGAAAUAAAAGCAAUUCAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001032288 | 3UTR | CAACUGUGAAAAGACACAUCACACAAUCACCUUGCUGCUGAUUACACGGCCUGGGGUCUCUGCCUUCUCCCCUUACCCUCCCGCCUCCCACCCUCCCUGCAACAACAGCCCUCUAGCCUGGGGGGCUUGUUAGAGUAGAUGUGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001032288 | 3UTR | UUAAAUUGAUUCCCAUCAUAACUGGUGGGGCACAUCUAACUCAACUGUGAAAAGACACAUCACACAAUCACCUUGCUGCUGAUUACACGGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000371657.5 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000371657.5 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000371657.5 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000371657.5 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000371657.5 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000371657.5 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-4291 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102445 CALU calumenin 2 4
MIRT108677 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT125969 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT179018 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT379033 CDK6 cyclin dependent kinase 6 2 6
MIRT442473 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 2
MIRT442910 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT442979 ZNF736 zinc finger protein 736 2 2
MIRT445663 TNFSF15 TNF superfamily member 15 2 2
MIRT446237 FZD6 frizzled class receptor 6 2 2
MIRT448860 FAM49B family with sequence similarity 49 member B 2 2
MIRT455559 TRAF1 TNF receptor associated factor 1 2 2
MIRT459704 ZNF641 zinc finger protein 641 2 2
MIRT460608 FEM1A fem-1 homolog A 2 2
MIRT462251 LAMA4 laminin subunit alpha 4 2 2
MIRT462469 FIZ1 FLT3 interacting zinc finger 1 2 2
MIRT466656 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT466841 STX6 syntaxin 6 2 2
MIRT471403 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471517 PCGF3 polycomb group ring finger 3 2 2
MIRT471681 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT472858 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT474813 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT474931 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475814 HDGF heparin binding growth factor 2 2
MIRT480434 C17orf49 chromosome 17 open reading frame 49 2 2
MIRT480903 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT481478 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT484982 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT485019 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT485036 TMEM189 transmembrane protein 189 2 8
MIRT495074 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT496004 CD180 CD180 molecule 2 2
MIRT500675 TRIM37 tripartite motif containing 37 2 2
MIRT504544 ZNF417 zinc finger protein 417 2 6
MIRT506782 KLHL15 kelch like family member 15 2 6
MIRT507256 FGF2 fibroblast growth factor 2 2 6
MIRT507386 EN2 engrailed homeobox 2 2 2
MIRT512505 BTBD19 BTB domain containing 19 2 2
MIRT516903 CTSB cathepsin B 2 2
MIRT528124 PPP1R10 protein phosphatase 1 regulatory subunit 10 2 2
MIRT528874 ATF3 activating transcription factor 3 2 2
MIRT536091 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT541079 RLIM ring finger protein, LIM domain interacting 2 2
MIRT541099 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT545360 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT545831 ZNF367 zinc finger protein 367 2 4
MIRT547115 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547312 NPTN neuroplastin 2 2
MIRT547959 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT549943 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT550749 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT565145 TUBB2A tubulin beta 2A class IIa 2 2
MIRT571050 POLQ DNA polymerase theta 2 2
MIRT571361 ZNF45 zinc finger protein 45 2 2
MIRT610133 FOXI2 forkhead box I2 2 2
MIRT613145 DSE dermatan sulfate epimerase 2 2
MIRT613379 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT615752 C6 complement C6 2 2
MIRT616460 ADRA2B adrenoceptor alpha 2B 2 2
MIRT616719 FEM1B fem-1 homolog B 2 2
MIRT618312 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT631491 RASSF4 Ras association domain family member 4 2 2
MIRT643134 PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 2 2
MIRT643482 DISC1 disrupted in schizophrenia 1 2 2
MIRT649715 TWSG1 twisted gastrulation BMP signaling modulator 1 2 2
MIRT653542 SLC38A7 solute carrier family 38 member 7 2 2
MIRT666307 SLC22A3 solute carrier family 22 member 3 2 2
MIRT692005 NAP1L4 nucleosome assembly protein 1 like 4 2 2
MIRT696838 ARL2BP ADP ribosylation factor like GTPase 2 binding protein 2 2
MIRT698204 TMEM248 transmembrane protein 248 2 2
MIRT703316 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 2 2
MIRT709376 FAM13A family with sequence similarity 13 member A 2 2
MIRT710112 MED23 mediator complex subunit 23 2 2
MIRT711975 HOMER2 homer scaffolding protein 2 2 2
MIRT712275 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT714108 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT719113 MAML1 mastermind like transcriptional coactivator 1 2 2
MIRT719727 SLC39A11 solute carrier family 39 member 11 2 2
MIRT720018 TFAP2C transcription factor AP-2 gamma 2 2
MIRT720358 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT720372 NUDT3 nudix hydrolase 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4291 Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-4291 Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-4291 Paclitaxel 36314 NSC125973 approved resistant High Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-4291 Doxorubicin 31703 NSC123127 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-4291 Radioactivity Iodine resistant High Papillary Thyroid Cancer tissue
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-4291 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4291 Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission