pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4445 |
Genomic Coordinates | chr3: 109602828 - 109602897 |
Description | Homo sapiens miR-4445 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4445-5p | |||||||||||||||||||||
Sequence | 8| AGAUUGUUUCUUUUGCCGUGCA |29 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TMEM189-UBE2V1 | ||||||||||||||||||||
Synonyms | CROC-1B, CROC1B, KUA-UEV | ||||||||||||||||||||
Description | TMEM189-UBE2V1 readthrough | ||||||||||||||||||||
Transcript | NM_199203 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TMEM189-UBE2V1 | |||||||||||||||||||||
3'UTR of TMEM189-UBE2V1 (miRNA target sites are highlighted) |
>TMEM189-UBE2V1|NM_199203|3'UTR 1 TCAAAAAGAAAAACCACAGGCCCTTCCCCTTCCCCCCAATTCGATTTAATCAGTCTTCATTTTCCACAGTAGTAAATTTT 81 CTAGATACGTCTTGTAGACCTCAAAGTACCGGAAAGGAAGCTCCCATTCAAAGGAAATTTATCTTAAGATACTGTAAATG 161 ATACTAATTTTTTGTCCATTTGAAATATATAAGTTGTGCTATAACAAATCATCCTGTCAAGTGTAACCACTGTCCACGTA 241 GTTGAACTTCTGGGATCAAGAAAGTCTATTTAAATTGATTCCCATCATAACTGGTGGGGCACATCTAACTCAACTGTGAA 321 AAGACACATCACACAATCACCTTGCTGCTGATTACACGGCCTGGGGTCTCTGCCTTCTCCCCTTACCCTCCCGCCTCCCA 401 CCCTCCCTGCAACAACAGCCCTCTAGCCTGGGGGGCTTGTTAGAGTAGATGTGAAGGTTTCAGGTCGCAGCCTGTGGGAC 481 TACTGCTAGGTGTGTGGGGTGTTTCGCCTGCACCCCTGGTTTCTTTAAGTCTTAAGTGATGCCCCTTCCAAACCATCATC 561 CTGTCCCCACGCTCCTCCACTCCCGCCCTTGGCCGAAGCATAGATTGTAACCCCTCCACTCCCCTCTGAGATTGGCCTTC 641 GGTGAGGAATTCAGGGCTTTCCCCATATCTTCTCTCCCCCACCTTTATCGAGGGGTGCTGCTTTTTCTCCCTCCTCCTCA 721 AGTTCCTTTTTGCACCGTCACCACCCAACACCTTCCATGACACTTCCTTGCTTTGGCCAGAAGCCATCAGGTAAGGTTGG 801 AAAGAGCCTCTGACCTCCCTTGTTTAGTTTTGGAACCATACTCACTCACTCTCCACCAGCCTGGGAAATGAATATTGGGT 881 CCTCAGCCCTGCCACCCTCTGCTGTCATCAGCTGATGCATTGTTTTTAGCTCAGGTTTTGATAAGGTGAAAAGAATAGTC 961 ACCAGGGTTACTCAGACCTGCCAGCTCTCGGAGTCCTTGGTGGTTGAACTTGGAGAAAGACCGCATGAAGATACTTGTAA 1041 GCACACATGATCCCTCTGAATTGTTTTACTTTCCTGTAACTGCTTTTGCTTTTAAAAATTGAAGAAGTTTTAAACAGGGC 1121 TTTCATTTGGTCATCCTTGCAATCCATTGGGGTCTAGTTTGGAATCTGACAACTGGAACAAAAAGAACCTTGAATCCGGT 1201 GCATGCCTTGGTTTTGGTGCTGCTGCTGCTTCCCAAGATCCTCAGCAGGGATTAAGAAGGAACCCGGTGTGCACAGCAGA 1281 TCCCCGAAATTGGTGGGCTTGACCTCCTGGCAAATTGCTGCGTCTTTCCACTTGCTGTTCAGGACCACTAAATGCTGAAA 1361 TGTGGATGCATACCGAAATAAAAGCAATTCATTGTGTACTAAAGGTTTTTTTTTTTTTTTTAATTTAGTATTTGTGTAAA 1441 ACCACCTTTTGAAGCAGCAACTATCAAGTCTGAAAAGCAATTGATGTTTCCATTAATCTTTTTCTGGGGGGAAAACCTTA 1521 GTTCTAAGGATTTAACATCCTGTAAGTGAAGTTTAACATAACAGTATTCCATAAGCAGCCTTTTTATTGTCAGACCATTG 1601 CCTGATTTTAATATAATAAAAAAAAAGTGTGCGTTAATATTTAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 387522.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 387522.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 5 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
Experimental Support 6 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000341698.2 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000341698.2 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000341698.2 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000341698.2 | 3UTR | ACACAUCACACAAUCACCUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000341698.2 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1065670 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
Location of target site | ENST00000341698.2 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1462573 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl BaL |
Location of target site | ENST00000341698.2 | 3UTR | ACACAUCACACAAUCACCUUGCUGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT063885 | RASSF8 | Ras association domain family member 8 | 2 | 6 | ||||||||
MIRT087576 | PTMA | prothymosin, alpha | 2 | 8 | ||||||||
MIRT092537 | KBTBD8 | kelch repeat and BTB domain containing 8 | 2 | 6 | ||||||||
MIRT204613 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | 2 | 8 | ||||||||
MIRT204644 | MOB4 | MOB family member 4, phocein | 2 | 8 | ||||||||
MIRT249009 | PUM1 | pumilio RNA binding family member 1 | 2 | 4 | ||||||||
MIRT305656 | MBNL1 | muscleblind like splicing regulator 1 | 2 | 2 | ||||||||
MIRT443971 | SSH2 | slingshot protein phosphatase 2 | 2 | 2 | ||||||||
MIRT457186 | ERC1 | ELKS/RAB6-interacting/CAST family member 1 | 2 | 2 | ||||||||
MIRT463721 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | 2 | 8 | ||||||||
MIRT466974 | STARD7 | StAR related lipid transfer domain containing 7 | 2 | 4 | ||||||||
MIRT473413 | MDM4 | MDM4, p53 regulator | 2 | 2 | ||||||||
MIRT484984 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | 2 | 8 | ||||||||
MIRT485021 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | 2 | 8 | ||||||||
MIRT485040 | TMEM189 | transmembrane protein 189 | 2 | 8 | ||||||||
MIRT503747 | CEP19 | centrosomal protein 19 | 2 | 6 | ||||||||
MIRT505080 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 4 | ||||||||
MIRT505649 | SHMT1 | serine hydroxymethyltransferase 1 | 2 | 4 | ||||||||
MIRT507020 | HMGA2 | high mobility group AT-hook 2 | 2 | 6 | ||||||||
MIRT507080 | GXYLT1 | glucoside xylosyltransferase 1 | 2 | 6 | ||||||||
MIRT507679 | COIL | coilin | 2 | 6 | ||||||||
MIRT511378 | IKZF3 | IKAROS family zinc finger 3 | 2 | 4 | ||||||||
MIRT528246 | BMS1 | BMS1, ribosome biogenesis factor | 2 | 2 | ||||||||
MIRT537033 | GREB1 | growth regulation by estrogen in breast cancer 1 | 2 | 2 | ||||||||
MIRT537063 | GPR176 | G protein-coupled receptor 176 | 2 | 2 | ||||||||
MIRT540927 | OIP5 | Opa interacting protein 5 | 2 | 2 | ||||||||
MIRT544346 | SNAP47 | synaptosome associated protein 47 | 2 | 2 | ||||||||
MIRT544749 | C8orf33 | chromosome 8 open reading frame 33 | 2 | 2 | ||||||||
MIRT552417 | ZNF460 | zinc finger protein 460 | 2 | 4 | ||||||||
MIRT554646 | ROBO1 | roundabout guidance receptor 1 | 2 | 2 | ||||||||
MIRT555803 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | 2 | 2 | ||||||||
MIRT557337 | HECTD2 | HECT domain E3 ubiquitin protein ligase 2 | 2 | 2 | ||||||||
MIRT563240 | QRFPR | pyroglutamylated RFamide peptide receptor | 2 | 2 | ||||||||
MIRT572692 | NCMAP | non-compact myelin associated protein | 2 | 2 | ||||||||
MIRT607777 | HS6ST3 | heparan sulfate 6-O-sulfotransferase 3 | 2 | 4 | ||||||||
MIRT612106 | CHRM3 | cholinergic receptor muscarinic 3 | 2 | 2 | ||||||||
MIRT616193 | SATB2 | SATB homeobox 2 | 2 | 2 | ||||||||
MIRT627774 | RAB30 | RAB30, member RAS oncogene family | 2 | 2 | ||||||||
MIRT691689 | FLOT2 | flotillin 2 | 2 | 2 | ||||||||
MIRT712623 | GTF2H5 | general transcription factor IIH subunit 5 | 2 | 2 | ||||||||
MIRT719695 | STX6 | syntaxin 6 | 2 | 2 | ||||||||
MIRT723575 | SWAP70 | SWAP switching B-cell complex subunit 70 | 2 | 2 | ||||||||
MIRT724077 | NCKAP1L | NCK associated protein 1 like | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|