miRTarBase - #MIRT485220


—
pre-miRNA Information
pre-miRNA hsa-mir-2355   
Genomic Coordinates chr2: 207109987 - 207110073
Description Homo sapiens miR-2355 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-2355-5p
Sequence 11| AUCCCCAGAUACAAUGGACAA |31
Evidence Experimental
Experiments SOLiD
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 2 - 207110063 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1268296297 4 dbSNP
rs1361046879 5 dbSNP
rs1219551997 6 dbSNP
rs1295756820 12 dbSNP
rs1345273529 15 dbSNP
rs977145706 15 dbSNP
rs1209629984 20 dbSNP
rs759940260 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PRICKLE1   
Synonyms EPM1B, RILP
Description prickle planar cell polarity protein 1
Transcript NM_001144881   
Other Transcripts NM_001144882 , NM_001144883 , NM_153026   
Expression
Putative miRNA Targets on PRICKLE1
3'UTR of PRICKLE1
(miRNA target sites are highlighted)		 
>PRICKLE1|NM_001144881|3'UTR
   1 CCAAGTAGTGATGCAGAGCATTTGTTTAAAACTTAGCCATTAACCGTCTGAATCGTTTCCTTTTCTTCCGTAGGAAAGTT
  81 GTGAAAATAGTTTAAAGTGCTTTCTTTGCCCATGTAAATGAGAACTCAACTGCTGTTTACAGTGTCAGATTAACATTTGA
 161 AAGGTGTGATTTCTCCAATTTACCCTCTTTGGATGGTGCCAGGTGGACGTGACATCTCGTGCCTGTCCGGTGCGGGTGCG
 241 TTACAGATGGACGTAGCTGCTTTGGTTTTCCAGTCCTCAAGGGAATACTGAAGATGCTGACTGAAGGGGATTGGATGTTG
 321 ATTTTAGAAGATGGAGAACTCCAGCCACCTTTGTAAAGCACTAGTGTTTGTCATTTATGTAAGTCAGGTCGGCTCAGGTC
 401 TTGATAGTCCGTCTTGGTGTGAGGCATGCCTGTCACGATGACCTAGCTAACACTGTGCATCTTATTGTGAGGCCAGCTTG
 481 TCCCCTCGAACCCTCTTTGGCCAGGTAAACATTGTATTGTATCAGCGCCAGCTACAGATTGAAAAAAAAAAACAAAAAAC
 561 ATTGCTATTTATAACTTAGTATTTCATAGACTTAAGTGTATTCCTAATTTAACGGTGCAAATATTAATGTATATACTGTA
 641 CAGTTCAGATTTTAAAGCTGATATTTTTATATCCCTGAATTGTAAGCCGTTTGTTACGCTGCAGTGCTAGATTTGCCAGG
 721 GAACCAGAATTTATGGATGAACTGATTGCTTATATTTTAGTCAGGGTTTATAAATGTAGATGGTCAAATTTACATTGCCT
 801 AGTGATGGAAAATTCAACTTTTTTTGATTTTTTTTTCCAATATTAAAAAAGGCTCTGTATGCATGGTGGGGCTATGTAAG
 881 TACTCTTTAAAACTATGGCCCTATTAATCTTACAAGTGTTACTTATGGGTCAAGCAATGTAAACTGTATAAATGTAAAAA
 961 CAACCCCTCCACACACATAACCCCTGGAATATATGGTAAAAACAAGTAGAAGCTGTTTCAGCGAGTGGGTTTTTTCCCCC
1041 TGCCTGCGGGGGGTGCCTTTCTCATTTTCAGCAAGGTGATGATTATCTCATGGGAAATGACAAAGATCTGCTTTTGTGGC
1121 AGAGGACTTTGTAGATTTGTTATTTTAAGAGAGGTTATTCCTTTTTATTCCTTCCCTCCCACTAATTTGTTGGCCTTTAA
1201 CAGCAATTTTGAAAACTGGGTCTTCTGGTTATGTTTTTGTTTTAAAATCTTTAAATTAGAGGATGCTGTGCCATTGAGTA
1281 CTGTAAGTTAATATGAGGTTCTGGTTCAAGGAAAACTTACGTTGGATCTGAACCAATGAGCAGATATTTTGATATGTGCC
1361 ACTCTTGCATATACATCTCAGTCCTAACTAAAGGTTCTAGTGGCATCCAGGACCTTTAGGGAGGCATTTAATAAACACTT
1441 AATAAATAACAAAACTACCTTTCTGAATATA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aacaGGUAACA---UAGACCCcua 5'
              | ||| |   | |||||   
Target 5' acagCAATTTTGAAAACTGGGtct 3'
 1200 - 1223 109.00 -7.12
2 
miRNA  3' aacAGGUA-ACAUA-GACCCCua 5'
             ||::| || ||  |||||  
Target 5' ggcTCTGTATGCATGGTGGGGct 3'
 851 - 873 106.00 -9.10
3 
miRNA  3' aacAGGUAACAU--AGACCCCUa 5'
             ||||  | |  |:| |||| 
Target 5' gcaTCCA--GGACCTTTAGGGAg 3'
 1403 - 1423 104.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
308699 142 ClinVar
308692 553 ClinVar
308691 596 ClinVar
308690 614 ClinVar
COSN30193310 16 COSMIC
COSN31499113 28 COSMIC
COSN25711350 46 COSMIC
COSN26990339 52 COSMIC
COSN13394974 55 COSMIC
COSN30471392 61 COSMIC
COSN24294679 69 COSMIC
COSN26505774 70 COSMIC
COSN19696825 91 COSMIC
COSN30103317 110 COSMIC
COSN30161650 122 COSMIC
COSN30101917 125 COSMIC
COSN30105903 127 COSMIC
COSN30512966 149 COSMIC
COSN30157224 159 COSMIC
COSN28575863 164 COSMIC
COSN26465699 166 COSMIC
COSN31573734 173 COSMIC
COSN16128489 175 COSMIC
COSN31555067 239 COSMIC
COSN5943549 246 COSMIC
COSN28805668 261 COSMIC
COSN32056265 448 COSMIC
COSN31780219 541 COSMIC
COSN20109490 542 COSMIC
COSN30604469 619 COSMIC
COSN26441336 640 COSMIC
COSN22780087 647 COSMIC
COSN4729745 650 COSMIC
COSN15451096 1111 COSMIC
COSN19559286 1483 COSMIC
COSN8662732 1522 COSMIC
COSN26308646 1644 COSMIC
COSN26852116 2383 COSMIC
COSN21340580 2521 COSMIC
COSN27788427 2533 COSMIC
COSN1573088 2773 COSMIC
COSN19213661 2977 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs555008439 2 dbSNP
rs567492165 3 dbSNP
rs1352321357 5 dbSNP
rs1169130185 16 dbSNP
rs975572062 19 dbSNP
rs1232020778 24 dbSNP
rs1465823788 29 dbSNP
rs1425258855 32 dbSNP
rs200644857 35 dbSNP
rs1475064590 38 dbSNP
rs372633476 45 dbSNP
rs147122337 46 dbSNP
rs1006433987 54 dbSNP
rs560130870 55 dbSNP
rs1259967666 57 dbSNP
rs1006587388 60 dbSNP
rs889360037 66 dbSNP
rs1213334895 69 dbSNP
rs759888600 70 dbSNP
rs1352919793 73 dbSNP
rs879051249 74 dbSNP
rs542130236 75 dbSNP
rs1313610054 82 dbSNP
rs1303609841 84 dbSNP
rs1043652 91 dbSNP
rs1368228903 103 dbSNP
rs151151770 104 dbSNP
rs1002844712 122 dbSNP
rs1216051756 124 dbSNP
rs572315226 129 dbSNP
rs1270630738 131 dbSNP
rs886049374 142 dbSNP
rs1306521011 148 dbSNP
rs1044446097 149 dbSNP
rs1384475012 163 dbSNP
rs1254545366 166 dbSNP
rs948822186 167 dbSNP
rs1466723783 170 dbSNP
rs1192532849 173 dbSNP
rs1246624194 175 dbSNP
rs1476035237 178 dbSNP
rs1363238484 198 dbSNP
rs1288689511 203 dbSNP
rs933606988 208 dbSNP
rs192612214 209 dbSNP
rs537460102 218 dbSNP
rs893252455 219 dbSNP
rs576421272 228 dbSNP
rs934526849 229 dbSNP
rs1393400042 230 dbSNP
rs1432848178 232 dbSNP
rs886049373 233 dbSNP
rs1339570016 239 dbSNP
rs1050986045 240 dbSNP
rs914697108 246 dbSNP
rs558237556 252 dbSNP
rs1184572649 253 dbSNP
rs1212459153 253 dbSNP
rs1043656 261 dbSNP
rs1448040638 262 dbSNP
rs937371198 268 dbSNP
rs920938635 270 dbSNP
rs1477697276 279 dbSNP
rs975140787 280 dbSNP
rs962774579 287 dbSNP
rs927309210 293 dbSNP
rs761391791 295 dbSNP
rs1162701364 296 dbSNP
rs558821449 296 dbSNP
rs1402570955 307 dbSNP
rs1316093994 309 dbSNP
rs1359894895 311 dbSNP
rs1345271478 318 dbSNP
rs909656134 327 dbSNP
rs984942989 332 dbSNP
rs570071895 335 dbSNP
rs1353105770 345 dbSNP
rs1252600886 355 dbSNP
rs1026542931 360 dbSNP
rs547699182 366 dbSNP
rs1227472724 370 dbSNP
rs1243652315 376 dbSNP
rs1279582201 378 dbSNP
rs1308624577 381 dbSNP
rs768200105 390 dbSNP
rs971387169 391 dbSNP
rs1228030183 395 dbSNP
rs1479934522 397 dbSNP
rs17091220 398 dbSNP
rs1199276265 399 dbSNP
rs568438224 402 dbSNP
rs745482621 407 dbSNP
rs781107806 410 dbSNP
rs1006659962 411 dbSNP
rs1339763564 421 dbSNP
rs1054485349 428 dbSNP
rs141738298 430 dbSNP
rs746977003 436 dbSNP
rs777503447 437 dbSNP
rs755082741 441 dbSNP
rs1446813624 443 dbSNP
rs1402057293 447 dbSNP
rs571674666 448 dbSNP
rs1460568879 454 dbSNP
rs1369470132 455 dbSNP
rs1167349830 458 dbSNP
rs1314444222 482 dbSNP
rs187632148 483 dbSNP
rs1250361995 488 dbSNP
rs998144344 489 dbSNP
rs563966550 492 dbSNP
rs933893865 493 dbSNP
rs1213366181 494 dbSNP
rs1357315340 497 dbSNP
rs921230484 500 dbSNP
rs946241194 502 dbSNP
rs1246641114 503 dbSNP
rs1315078249 504 dbSNP
rs1308388132 505 dbSNP
rs1240742920 507 dbSNP
rs1378531808 508 dbSNP
rs1235704484 511 dbSNP
rs1039758268 516 dbSNP
rs766425066 517 dbSNP
rs1439799236 518 dbSNP
rs1482461479 521 dbSNP
rs941065100 523 dbSNP
rs1295669491 526 dbSNP
rs12658 527 dbSNP
rs750610528 528 dbSNP
rs527422458 533 dbSNP
rs1179668567 539 dbSNP
rs1159827002 541 dbSNP
rs1237676985 542 dbSNP
rs937443151 542 dbSNP
rs767986403 546 dbSNP
rs950820414 551 dbSNP
rs778702730 552 dbSNP
rs68074167 553 dbSNP
rs756462439 553 dbSNP
rs76259006 553 dbSNP
rs778238511 553 dbSNP
rs919431022 553 dbSNP
rs1269673241 554 dbSNP
rs1211446741 560 dbSNP
rs762030087 565 dbSNP
rs1398105770 578 dbSNP
rs1389355537 579 dbSNP
rs1330035068 582 dbSNP
rs1371070079 586 dbSNP
rs1045737690 587 dbSNP
rs1338102977 592 dbSNP
rs757584408 593 dbSNP
rs769616581 596 dbSNP
rs1337547469 599 dbSNP
rs775224782 613 dbSNP
rs886049372 614 dbSNP
rs1353811133 615 dbSNP
rs962510492 618 dbSNP
rs1331057395 635 dbSNP
rs1392173415 650 dbSNP
rs1395931187 667 dbSNP
rs567650778 682 dbSNP
rs1432529493 683 dbSNP
rs1193586837 684 dbSNP
rs1374609915 687 dbSNP
rs909736109 688 dbSNP
rs1013306925 689 dbSNP
rs1394843172 693 dbSNP
rs1462542528 694 dbSNP
rs749474350 697 dbSNP
rs1366021818 698 dbSNP
rs957388280 700 dbSNP
rs1296675050 704 dbSNP
rs1328542199 714 dbSNP
rs147942021 715 dbSNP
rs1418440779 718 dbSNP
rs998904108 724 dbSNP
rs1163979806 733 dbSNP
rs1029735769 737 dbSNP
rs997899927 747 dbSNP
rs966677157 754 dbSNP
rs1263823330 759 dbSNP
rs1474071950 760 dbSNP
rs1476717948 762 dbSNP
rs1020562794 765 dbSNP
rs1192740227 766 dbSNP
rs1418050134 770 dbSNP
rs903312101 775 dbSNP
rs1365190102 779 dbSNP
rs1182165434 780 dbSNP
rs1178435834 781 dbSNP
rs1348816047 799 dbSNP
rs778118882 802 dbSNP
rs1010458078 809 dbSNP
rs1436850323 820 dbSNP
rs1050882586 826 dbSNP
rs1277972303 833 dbSNP
rs1214969723 836 dbSNP
rs1054552580 837 dbSNP
rs746752965 837 dbSNP
rs1274288454 843 dbSNP
rs905980386 851 dbSNP
rs756303597 859 dbSNP
rs1239944757 863 dbSNP
rs1354764639 868 dbSNP
rs1262403686 874 dbSNP
rs1487273455 876 dbSNP
rs1215536384 889 dbSNP
rs1258000491 890 dbSNP
rs1486419122 893 dbSNP
rs1281620608 894 dbSNP
rs899733164 895 dbSNP
rs368596743 897 dbSNP
rs1240084806 898 dbSNP
rs542060460 900 dbSNP
rs1419149956 903 dbSNP
rs1160673284 913 dbSNP
rs551815384 914 dbSNP
rs574754036 926 dbSNP
rs1335371231 929 dbSNP
rs555892431 932 dbSNP
rs1376424556 933 dbSNP
rs749282719 944 dbSNP
rs752821017 949 dbSNP
rs940999777 964 dbSNP
rs1307220528 978 dbSNP
rs73126459 983 dbSNP
rs1395144875 992 dbSNP
rs1224348878 997 dbSNP
rs537803462 1012 dbSNP
rs1046811751 1013 dbSNP
rs756229345 1023 dbSNP
rs1351361190 1029 dbSNP
rs1459805912 1035 dbSNP
rs201368761 1036 dbSNP
rs759701217 1036 dbSNP
rs1158908180 1038 dbSNP
rs1207839858 1040 dbSNP
rs1236475190 1042 dbSNP
rs543795157 1044 dbSNP
rs533279850 1046 dbSNP
rs11181513 1047 dbSNP
rs1235854933 1048 dbSNP
rs1194969186 1053 dbSNP
rs985326328 1054 dbSNP
rs1251828634 1062 dbSNP
rs1396284306 1063 dbSNP
rs182902189 1071 dbSNP
rs751878241 1079 dbSNP
rs1174411803 1082 dbSNP
rs1358729222 1089 dbSNP
rs1443240008 1098 dbSNP
rs953774320 1105 dbSNP
rs950261958 1108 dbSNP
rs557897526 1111 dbSNP
rs916127531 1119 dbSNP
rs1450367743 1123 dbSNP
rs922398634 1132 dbSNP
rs1286824699 1144 dbSNP
rs1206051437 1148 dbSNP
rs1350263292 1149 dbSNP
rs1217197587 1152 dbSNP
rs991759765 1153 dbSNP
rs1307669860 1160 dbSNP
rs1206158238 1162 dbSNP
rs957334610 1167 dbSNP
rs1255806727 1168 dbSNP
rs192161217 1170 dbSNP
rs1456929665 1176 dbSNP
rs1193786766 1181 dbSNP
rs572465188 1182 dbSNP
rs1479290129 1185 dbSNP
rs1371905497 1196 dbSNP
rs886049371 1218 dbSNP
rs1189800722 1219 dbSNP
rs1424929957 1225 dbSNP
rs1032968000 1226 dbSNP
rs1021057976 1263 dbSNP
rs977431300 1265 dbSNP
rs1398461960 1268 dbSNP
rs957623433 1273 dbSNP
rs967417940 1275 dbSNP
rs1669933 1283 dbSNP
rs376939377 1290 dbSNP
rs572638131 1290 dbSNP
rs1274236796 1291 dbSNP
rs886049370 1292 dbSNP
rs1362363197 1293 dbSNP
rs1399836769 1294 dbSNP
rs1358234458 1298 dbSNP
rs998398252 1320 dbSNP
rs1316939816 1321 dbSNP
rs899681597 1321 dbSNP
rs1213698140 1326 dbSNP
rs1001695167 1330 dbSNP
rs1394001285 1334 dbSNP
rs1018569406 1345 dbSNP
rs1219973739 1355 dbSNP
rs1191167960 1361 dbSNP
rs535656837 1365 dbSNP
rs568374912 1368 dbSNP
rs1244291615 1374 dbSNP
rs1165686513 1378 dbSNP
rs1392944325 1383 dbSNP
rs1403719056 1388 dbSNP
rs1194366877 1392 dbSNP
rs1051453 1394 dbSNP
rs1345779107 1398 dbSNP
rs1014775022 1400 dbSNP
rs929649582 1414 dbSNP
rs1339396534 1415 dbSNP
rs1233546140 1442 dbSNP
rs1285641906 1448 dbSNP
rs3168685 1450 dbSNP
rs1353605272 1455 dbSNP
rs1213364743 1469 dbSNP
rs1289774130 1475 dbSNP
rs372755792 1483 dbSNP
rs1219197629 1489 dbSNP
rs1261511113 1493 dbSNP
rs1279757567 1495 dbSNP
rs1217497370 1497 dbSNP
rs1188886557 1502 dbSNP
rs941251146 1511 dbSNP
rs1341403761 1515 dbSNP
rs1471845433 1530 dbSNP
rs1270627607 1549 dbSNP
rs1046167228 1553 dbSNP
rs1338217432 1556 dbSNP
rs888405275 1556 dbSNP
rs776302613 1558 dbSNP
rs1415056705 1563 dbSNP
rs1374430352 1565 dbSNP
rs932529413 1567 dbSNP
rs763728080 1569 dbSNP
rs922440625 1571 dbSNP
rs976505476 1572 dbSNP
rs945120413 1574 dbSNP
rs1446575594 1578 dbSNP
rs183227145 1581 dbSNP
rs1354989398 1583 dbSNP
rs1411101483 1583 dbSNP
rs1422280184 1593 dbSNP
rs1212117450 1598 dbSNP
rs760160332 1613 dbSNP
rs936255852 1623 dbSNP
rs1475367380 1624 dbSNP
rs1233549804 1626 dbSNP
rs1441680977 1628 dbSNP
rs1156738735 1631 dbSNP
rs1379691568 1634 dbSNP
rs1435092829 1637 dbSNP
rs1174121071 1639 dbSNP
rs926231965 1640 dbSNP
rs977380353 1646 dbSNP
rs796743673 1650 dbSNP
rs1033254961 1655 dbSNP
rs967364064 1659 dbSNP
rs1486139811 1678 dbSNP
rs1257005975 1683 dbSNP
rs1208115066 1690 dbSNP
rs1439698471 1693 dbSNP
rs559867316 1694 dbSNP
rs970230192 1703 dbSNP
rs775005543 1704 dbSNP
rs1459142716 1715 dbSNP
rs751953066 1722 dbSNP
rs75928604 1723 dbSNP
rs1454659903 1725 dbSNP
rs1200684630 1728 dbSNP
rs527344391 1733 dbSNP
rs897266568 1735 dbSNP
rs1015601189 1748 dbSNP
rs964183705 1750 dbSNP
rs1005581232 1754 dbSNP
rs1168130200 1767 dbSNP
rs1402090726 1769 dbSNP
rs1018097912 1775 dbSNP
rs1330094540 1778 dbSNP
rs1400154011 1779 dbSNP
rs1315949505 1782 dbSNP
rs566464447 1786 dbSNP
rs771907608 1787 dbSNP
rs548356397 1792 dbSNP
rs529920987 1796 dbSNP
rs1304122363 1808 dbSNP
rs562710168 1809 dbSNP
rs566987905 1814 dbSNP
rs1354447170 1815 dbSNP
rs1300648682 1816 dbSNP
rs1320288406 1823 dbSNP
rs548727706 1825 dbSNP
rs745776678 1837 dbSNP
rs906202973 1859 dbSNP
rs530346632 1861 dbSNP
rs532325264 1864 dbSNP
rs1465597792 1866 dbSNP
rs1488738760 1868 dbSNP
rs945136342 1869 dbSNP
rs145255245 1874 dbSNP
rs1432370336 1875 dbSNP
rs1194131218 1879 dbSNP
rs774311546 1880 dbSNP
rs1055949678 1881 dbSNP
rs1169277525 1884 dbSNP
rs936202063 1885 dbSNP
rs770898842 1888 dbSNP
rs190217366 1892 dbSNP
rs1459033576 1895 dbSNP
rs1295800870 1897 dbSNP
rs564473531 1898 dbSNP
rs1413519745 1902 dbSNP
rs540407499 1903 dbSNP
rs1299195699 1906 dbSNP
rs1342566886 1917 dbSNP
rs1217058042 1925 dbSNP
rs149975921 1933 dbSNP
rs1322400673 1937 dbSNP
rs1247156452 1943 dbSNP
rs1471266574 1944 dbSNP
rs1263543593 1945 dbSNP
rs1488118374 1947 dbSNP
rs1217014730 1950 dbSNP
rs1233562498 1952 dbSNP
rs1487211951 1965 dbSNP
rs572457462 1965 dbSNP
rs1192447154 1968 dbSNP
rs1414160468 1969 dbSNP
rs1425031474 1970 dbSNP
rs1162109287 1973 dbSNP
rs1367168625 1973 dbSNP
rs977189563 1976 dbSNP
rs1203852672 1993 dbSNP
rs1456401688 1995 dbSNP
rs964156770 2003 dbSNP
rs1274913968 2007 dbSNP
rs1214105402 2016 dbSNP
rs1362822749 2020 dbSNP
rs911317404 2036 dbSNP
rs983939642 2041 dbSNP
rs1310300039 2043 dbSNP
rs1225167806 2045 dbSNP
rs553859437 2046 dbSNP
rs952544623 2048 dbSNP
rs111928412 2049 dbSNP
rs1320990127 2050 dbSNP
rs1240753248 2053 dbSNP
rs1288130284 2066 dbSNP
rs144959796 2066 dbSNP
rs1373571331 2078 dbSNP
rs1215703758 2088 dbSNP
rs1025530366 2089 dbSNP
rs139544221 2091 dbSNP
rs1484032838 2093 dbSNP
rs574688977 2100 dbSNP
rs749062636 2103 dbSNP
rs1012350405 2105 dbSNP
rs1439826027 2106 dbSNP
rs1179808759 2108 dbSNP
rs778208757 2111 dbSNP
rs369379331 2112 dbSNP
rs1398742709 2143 dbSNP
rs1418190599 2146 dbSNP
rs1005651778 2148 dbSNP
rs1359919935 2150 dbSNP
rs1328596797 2156 dbSNP
rs1301361111 2158 dbSNP
rs894881881 2162 dbSNP
rs1349709907 2170 dbSNP
rs2053943 2173 dbSNP
rs1374590468 2175 dbSNP
rs1239080445 2181 dbSNP
rs996739215 2188 dbSNP
rs146751664 2189 dbSNP
rs904701930 2195 dbSNP
rs1178119926 2200 dbSNP
rs61924366 2202 dbSNP
rs946311748 2203 dbSNP
rs143526581 2208 dbSNP
rs182962207 2210 dbSNP
rs1263499928 2211 dbSNP
rs1217629861 2212 dbSNP
rs942722501 2230 dbSNP
rs911288795 2233 dbSNP
rs755474023 2234 dbSNP
rs984209607 2235 dbSNP
rs566530237 2236 dbSNP
rs139917735 2237 dbSNP
rs146444442 2248 dbSNP
rs1237501741 2249 dbSNP
rs1275416194 2250 dbSNP
rs1372610779 2251 dbSNP
rs77272764 2257 dbSNP
rs1217321316 2261 dbSNP
rs1442331067 2264 dbSNP
rs970653834 2267 dbSNP
rs1318163453 2269 dbSNP
rs1025341174 2275 dbSNP
rs150550386 2277 dbSNP
rs1456967269 2278 dbSNP
rs117254564 2281 dbSNP
rs1247867487 2286 dbSNP
rs984165035 2290 dbSNP
rs73126453 2293 dbSNP
rs750770045 2300 dbSNP
rs1000577006 2301 dbSNP
rs370263993 2303 dbSNP
rs564142136 2308 dbSNP
rs1172847284 2314 dbSNP
rs1421549641 2316 dbSNP
rs902305105 2320 dbSNP
rs1409495627 2323 dbSNP
rs1351559871 2331 dbSNP
rs145126550 2331 dbSNP
rs142622811 2339 dbSNP
rs546139033 2340 dbSNP
rs117114511 2355 dbSNP
rs1174308271 2364 dbSNP
rs560160405 2364 dbSNP
rs1041704731 2381 dbSNP
rs1228457256 2383 dbSNP
rs1291152654 2391 dbSNP
rs191123770 2393 dbSNP
rs889800776 2396 dbSNP
rs1219776988 2405 dbSNP
rs892263269 2409 dbSNP
rs1048461892 2412 dbSNP
rs1196076701 2414 dbSNP
rs1000563546 2421 dbSNP
rs1349558220 2423 dbSNP
rs1475091503 2423 dbSNP
rs1415822250 2425 dbSNP
rs904990412 2426 dbSNP
rs931385379 2429 dbSNP
rs1360892893 2437 dbSNP
rs949103263 2442 dbSNP
rs917602594 2451 dbSNP
rs1325507590 2455 dbSNP
rs1057498401 2457 dbSNP
rs1312133600 2461 dbSNP
rs758444670 2463 dbSNP
rs918698499 2465 dbSNP
rs972549136 2466 dbSNP
rs940256544 2474 dbSNP
rs908674407 2477 dbSNP
rs1354862188 2478 dbSNP
rs1219325053 2480 dbSNP
rs1284065717 2487 dbSNP
rs1446669076 2493 dbSNP
rs1188275211 2498 dbSNP
rs574625750 2501 dbSNP
rs949256701 2509 dbSNP
rs917818637 2510 dbSNP
rs991145468 2514 dbSNP
rs1398430221 2516 dbSNP
rs556303664 2517 dbSNP
rs760306779 2526 dbSNP
rs1031959907 2529 dbSNP
rs1156621240 2531 dbSNP
rs1383748840 2541 dbSNP
rs921372217 2545 dbSNP
rs979105295 2547 dbSNP
rs1338159593 2554 dbSNP
rs1314950878 2557 dbSNP
rs148420846 2561 dbSNP
rs760330282 2577 dbSNP
rs1375993475 2585 dbSNP
rs144508812 2593 dbSNP
rs1281069045 2598 dbSNP
rs1440756988 2600 dbSNP
rs2708059 2603 dbSNP
rs1422704392 2605 dbSNP
rs1176497661 2606 dbSNP
rs187054245 2608 dbSNP
rs1478257092 2609 dbSNP
rs1173964217 2618 dbSNP
rs200768720 2624 dbSNP
rs58364296 2625 dbSNP
rs1399690486 2626 dbSNP
rs554018745 2626 dbSNP
rs1331476542 2627 dbSNP
rs11404256 2632 dbSNP
rs1305543591 2632 dbSNP
rs1364539110 2632 dbSNP
rs1401598329 2632 dbSNP
rs1449624097 2632 dbSNP
rs397811612 2632 dbSNP
rs1199389587 2633 dbSNP
rs1482029425 2637 dbSNP
rs1032135686 2638 dbSNP
rs1459186644 2640 dbSNP
rs1252542635 2644 dbSNP
rs572870708 2645 dbSNP
rs1230325631 2659 dbSNP
rs1002125140 2665 dbSNP
rs1319177159 2667 dbSNP
rs1019831446 2668 dbSNP
rs545230106 2672 dbSNP
rs142688058 2673 dbSNP
rs1171010278 2676 dbSNP
rs1313644486 2678 dbSNP
rs1463664062 2683 dbSNP
rs1395654905 2688 dbSNP
rs536321516 2702 dbSNP
rs568997831 2707 dbSNP
rs556430720 2708 dbSNP
rs180941982 2719 dbSNP
rs1404548625 2720 dbSNP
rs1279130142 2724 dbSNP
rs1399388187 2728 dbSNP
rs897216764 2738 dbSNP
rs1476025188 2739 dbSNP
rs11181512 2750 dbSNP
rs1037542314 2754 dbSNP
rs538466583 2755 dbSNP
rs571460151 2756 dbSNP
rs138689285 2759 dbSNP
rs1193926870 2761 dbSNP
rs1264952858 2762 dbSNP
rs189360392 2766 dbSNP
rs887396494 2769 dbSNP
rs560098826 2775 dbSNP
rs372777083 2776 dbSNP
rs1458887687 2777 dbSNP
rs1165563677 2788 dbSNP
rs1195831001 2800 dbSNP
rs530104841 2803 dbSNP
rs1458624796 2806 dbSNP
rs925224076 2811 dbSNP
rs1342628244 2819 dbSNP
rs1257915108 2826 dbSNP
rs1197150339 2828 dbSNP
rs1294970373 2831 dbSNP
rs975865112 2832 dbSNP
rs562643643 2835 dbSNP
rs944145302 2836 dbSNP
rs1217076521 2839 dbSNP
rs1285130550 2840 dbSNP
rs538292842 2842 dbSNP
rs1484705488 2862 dbSNP
rs1185384280 2869 dbSNP
rs912545895 2875 dbSNP
rs770988760 2879 dbSNP
rs988140950 2888 dbSNP
rs567564071 2896 dbSNP
rs966360081 2898 dbSNP
rs1309263563 2908 dbSNP
rs1020635180 2910 dbSNP
rs969603061 2911 dbSNP
rs976246005 2915 dbSNP
rs965857909 2918 dbSNP
rs1397918692 2919 dbSNP
rs1312753750 2922 dbSNP
rs1381947951 2927 dbSNP
rs1240550771 2931 dbSNP
rs866200910 2931 dbSNP
rs1020201695 2935 dbSNP
rs555766994 2938 dbSNP
rs1391976096 2944 dbSNP
rs1023468349 2949 dbSNP
rs34120942 2951 dbSNP
rs544748550 2951 dbSNP
rs773086939 2952 dbSNP
rs1256298032 2958 dbSNP
rs1483939622 2961 dbSNP
rs1201247449 2966 dbSNP
rs1241768675 2968 dbSNP
rs1007084498 2972 dbSNP
rs117521309 2974 dbSNP
rs1162405327 2976 dbSNP
rs1410578009 2978 dbSNP
rs1456097621 2979 dbSNP
rs1365134245 2980 dbSNP
rs1417772314 2980 dbSNP
rs565518805 2981 dbSNP
rs1181921207 2982 dbSNP
rs1014596103 2983 dbSNP
rs1004574130 2984 dbSNP
rs1438473148 2989 dbSNP
rs1235827090 2993 dbSNP
rs147534900 2998 dbSNP
rs573596628 3001 dbSNP
rs1048647838 3006 dbSNP
rs995483745 3011 dbSNP
rs769848547 3022 dbSNP
rs1370907968 3027 dbSNP
rs370969768 3039 dbSNP
rs1301465403 3041 dbSNP
rs376514105 3043 dbSNP
rs1221113466 3044 dbSNP
rs748366241 3045 dbSNP
rs1261992295 3048 dbSNP
rs1262642188 3050 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000455697.1 | 3UTR | CCACACAAGGGUUUGUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.495 0 -0.400 0.01 32 Click to see details
CHOL -0.688 0.02 -0.717 0.01 9 Click to see details
PRAD 0.237 0.05 0.217 0.07 50 Click to see details
KICH 0.33 0.05 0.342 0.05 25 Click to see details
BRCA 0.136 0.11 0.168 0.06 84 Click to see details
KIRC -0.144 0.12 -0.039 0.38 68 Click to see details
BLCA -0.221 0.19 -0.321 0.1 18 Click to see details
LUAD -0.248 0.22 -0.168 0.3 12 Click to see details
CESC -0.687 0.26 -0.500 0.33 3 Click to see details
KIRP -0.118 0.26 -0.143 0.22 32 Click to see details
LIHC 0.085 0.28 0.092 0.26 49 Click to see details
ESCA 0.166 0.31 0.200 0.28 11 Click to see details
HNSC -0.069 0.33 -0.002 0.49 42 Click to see details
PCPG 0.419 0.36 0.500 0.33 3 Click to see details
UCEC -0.081 0.37 -0.068 0.39 19 Click to see details
LUSC 0.052 0.38 0.059 0.36 38 Click to see details
THCA -0.019 0.44 0.095 0.24 59 Click to see details
PAAD 0.024 0.49 -0.200 0.4 4 Click to see details
PAAD 0.024 0.49 -0.200 0.4 4 Click to see details
164 hsa-miR-2355-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT190653 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT286477 TAOK1 TAO kinase 1 2 4
MIRT318993 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT345622 DCAF7 DDB1 and CUL4 associated factor 7 2 4
MIRT442513 SYT7 synaptotagmin 7 2 4
MIRT444247 CTNND1 catenin delta 1 2 2
MIRT444780 ECE1 endothelin converting enzyme 1 2 2
MIRT456525 TMEM63A transmembrane protein 63A 2 2
MIRT468960 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469834 R3HDM4 R3H domain containing 4 2 2
MIRT470027 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT471167 PHB2 prohibitin 2 2 2
MIRT475819 HDGF heparin binding growth factor 2 4
MIRT479389 CDKN1B cyclin dependent kinase inhibitor 1B 2 6
MIRT481747 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT485220 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT487259 CCNF cyclin F 2 2
MIRT489971 MCC mutated in colorectal cancers 2 4
MIRT491399 C1D C1D nuclear receptor corepressor 2 2
MIRT494959 CCDC144A coiled-coil domain containing 144A 2 4
MIRT494979 PPP5D1 PPP5 tetratricopeptide repeat domain containing 1 2 2
MIRT495225 CHST14 carbohydrate sulfotransferase 14 2 2
MIRT496550 TBX15 T-box 15 2 2
MIRT501612 PISD phosphatidylserine decarboxylase 2 2
MIRT509393 TRIM24 tripartite motif containing 24 2 2
MIRT519616 ZNF788 zinc finger family member 788 2 4
MIRT519738 ZNF394 zinc finger protein 394 2 4
MIRT521230 SAR1A secretion associated Ras related GTPase 1A 2 4
MIRT521801 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT526233 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT526932 CMSS1 cms1 ribosomal small subunit homolog (yeast) 2 2
MIRT529189 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT529329 ZNF649 zinc finger protein 649 2 2
MIRT529698 MRPL30 mitochondrial ribosomal protein L30 2 2
MIRT529921 TOP1MT DNA topoisomerase I mitochondrial 2 2
MIRT530032 SMC1A structural maintenance of chromosomes 1A 2 2
MIRT530898 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT531621 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT533132 XIAP X-linked inhibitor of apoptosis 2 2
MIRT533210 WAPAL WAPL cohesin release factor 2 2
MIRT534058 ST6GALNAC3 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 2 2
MIRT535487 PARVB parvin beta 2 2
MIRT536749 HOXD9 homeobox D9 2 2
MIRT551456 CARKD NAD(P)HX dehydratase 2 2
MIRT551858 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT552095 FAM8A1 family with sequence similarity 8 member A1 2 2
MIRT552332 ZNF704 zinc finger protein 704 2 2
MIRT552549 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT561505 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT562702 ZNF415 zinc finger protein 415 2 2
MIRT563052 ZNF138 zinc finger protein 138 2 2
MIRT564592 ZNF791 zinc finger protein 791 2 2
MIRT566422 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 2
MIRT570176 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT570866 ZNF525 zinc finger protein 525 2 2
MIRT570875 ZFP1 ZFP1 zinc finger protein 2 2
MIRT571517 ZNF625 zinc finger protein 625 2 2
MIRT572551 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT610894 HINFP histone H4 transcription factor 2 2
MIRT611037 PTGES prostaglandin E synthase 2 2
MIRT611479 HSPA4 heat shock protein family A (Hsp70) member 4 2 4
MIRT612419 SP1 Sp1 transcription factor 2 2
MIRT614478 FRMPD3 FERM and PDZ domain containing 3 2 2
MIRT616318 CACNA1A calcium voltage-gated channel subunit alpha1 A 2 2
MIRT616929 ZNF638 zinc finger protein 638 2 2
MIRT618131 GABARAPL3 GABA type A receptor associated protein like 3 pseudogene 2 2
MIRT618452 ZFP30 ZFP30 zinc finger protein 2 4
MIRT620671 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620713 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT621126 EMC7 ER membrane protein complex subunit 7 2 4
MIRT621443 TOMM22 translocase of outer mitochondrial membrane 22 2 2
MIRT623491 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623783 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT623918 FNBP1L formin binding protein 1 like 2 2
MIRT625723 CXorf38 chromosome X open reading frame 38 2 2
MIRT625778 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 2 2
MIRT626940 TTR transthyretin 2 2
MIRT627357 TSC22D2 TSC22 domain family member 2 2 2
MIRT632078 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT633361 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT639793 MVK mevalonate kinase 2 2
MIRT643761 NAGK N-acetylglucosamine kinase 2 2
MIRT644358 NDUFAF6 NADH:ubiquinone oxidoreductase complex assembly factor 6 2 2
MIRT645558 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT646588 ANKRD36 ankyrin repeat domain 36 2 2
MIRT646631 SLC25A46 solute carrier family 25 member 46 2 2
MIRT648066 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT648142 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 2 2
MIRT648416 MYOZ3 myozenin 3 2 2
MIRT649218 AMMECR1L AMMECR1 like 2 2
MIRT649772 MRPS27 mitochondrial ribosomal protein S27 2 4
MIRT650510 UFM1 ubiquitin fold modifier 1 2 2
MIRT651007 ZNF740 zinc finger protein 740 2 2
MIRT651524 WNT2B Wnt family member 2B 2 2
MIRT652014 TTYH3 tweety family member 3 2 2
MIRT652513 TMEM109 transmembrane protein 109 2 2
MIRT652686 THUMPD3 THUMP domain containing 3 2 2
MIRT652772 TENM3 teneurin transmembrane protein 3 2 2
MIRT653160 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT653765 SIX5 SIX homeobox 5 2 2
MIRT653792 SIRPA signal regulatory protein alpha 2 2
MIRT655649 OAZ2 ornithine decarboxylase antizyme 2 2 2
MIRT656263 MEX3A mex-3 RNA binding family member A 2 2
MIRT657044 KCNH6 potassium voltage-gated channel subfamily H member 6 2 2
MIRT657375 HMGA1 high mobility group AT-hook 1 2 2
MIRT657532 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT657542 GSTO2 glutathione S-transferase omega 2 2 2
MIRT657828 GJD3 gap junction protein delta 3 2 2
MIRT658946 DOK6 docking protein 6 2 2
MIRT660363 BACH2 BTB domain and CNC homolog 2 2 2
MIRT660406 ATXN7L3 ataxin 7 like 3 2 2
MIRT660948 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT661031 AAK1 AP2 associated kinase 1 2 2
MIRT662435 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT668419 FAM217B family with sequence similarity 217 member B 2 2
MIRT669332 BSND barttin CLCNK type accessory beta subunit 2 2
MIRT676105 CLUAP1 clusterin associated protein 1 2 2
MIRT677084 SMIM15 small integral membrane protein 15 2 2
MIRT677127 OGFOD3 2-oxoglutarate and iron dependent oxygenase domain containing 3 2 2
MIRT678001 CPM carboxypeptidase M 2 2
MIRT678531 TMEM78 transmembrane protein 78 2 2
MIRT680000 ZNF860 zinc finger protein 860 2 2
MIRT680098 PXMP4 peroxisomal membrane protein 4 2 2
MIRT686795 SOX12 SRY-box 12 2 2
MIRT698887 SPTBN2 spectrin beta, non-erythrocytic 2 2 2
MIRT699371 SLC30A6 solute carrier family 30 member 6 2 2
MIRT702005 MIDN midnolin 2 2
MIRT708101 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT709563 GYG2 glycogenin 2 2 2
MIRT710559 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT710585 CDCA4 cell division cycle associated 4 2 2
MIRT710873 NT5DC1 5'-nucleotidase domain containing 1 2 2
MIRT711876 VASP vasodilator stimulated phosphoprotein 2 2
MIRT712226 RIMS3 regulating synaptic membrane exocytosis 3 2 2
MIRT713211 FAM13A family with sequence similarity 13 member A 2 2
MIRT713261 GPR55 G protein-coupled receptor 55 2 2
MIRT713327 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT713889 RNF19B ring finger protein 19B 2 2
MIRT714015 UBAP2L ubiquitin associated protein 2 like 2 2
MIRT714202 NLRP12 NLR family pyrin domain containing 12 2 2
MIRT714717 VPS8 VPS8, CORVET complex subunit 2 2
MIRT714748 ZNF385D zinc finger protein 385D 2 2
MIRT714806 ARHGEF19 Rho guanine nucleotide exchange factor 19 2 2
MIRT714852 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif 17 2 2
MIRT715717 MRPL4 mitochondrial ribosomal protein L4 2 2
MIRT715852 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT716853 MFSD12 major facilitator superfamily domain containing 12 2 2
MIRT717134 EBPL emopamil binding protein like 2 2
MIRT717248 TMEM246 transmembrane protein 246 2 2
MIRT717997 ZNF79 zinc finger protein 79 2 2
MIRT718341 PURA purine rich element binding protein A 2 2
MIRT719587 TFCP2L1 transcription factor CP2 like 1 2 2
MIRT720520 PTGR2 prostaglandin reductase 2 2 2
MIRT720671 SLC39A13 solute carrier family 39 member 13 2 2
MIRT721213 DCLK3 doublecortin like kinase 3 2 2
MIRT721757 INF2 inverted formin, FH2 and WH2 domain containing 2 2
MIRT721826 POU6F1 POU class 6 homeobox 1 2 2
MIRT722091 SUSD1 sushi domain containing 1 2 2
MIRT722275 LURAP1 leucine rich adaptor protein 1 2 2
MIRT722802 ARHGAP19 Rho GTPase activating protein 19 2 2
MIRT722866 FAM212B family with sequence similarity 212 member B 2 2
MIRT723113 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT724378 NEK8 NIMA related kinase 8 2 2
MIRT732775 PYCR1 pyrroline-5-carboxylate reductase 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2355 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2355-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-2355-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-2355-5p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-2355-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-2355-5p Temozolomide 5394 NSC362856 approved resistant High Glioma tissue
hsa-miR-2355-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-2355-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-2355-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2355-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2355-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission